ID: 926120781

View in Genome Browser
Species Human (GRCh38)
Location 2:10240258-10240280
Sequence GTACTAGGTGGTTCTCGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926120781_926120791 6 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120791 2:10240287-10240309 CTGCACCGGGCCAGAGGCCCAGG No data
926120781_926120788 -7 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120788 2:10240274-10240296 CTAGTACCTGCAGCTGCACCGGG No data
926120781_926120790 0 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120790 2:10240281-10240303 CTGCAGCTGCACCGGGCCAGAGG No data
926120781_926120787 -8 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120787 2:10240273-10240295 CCTAGTACCTGCAGCTGCACCGG No data
926120781_926120792 7 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120792 2:10240288-10240310 TGCACCGGGCCAGAGGCCCAGGG No data
926120781_926120795 18 Left 926120781 2:10240258-10240280 CCCCCACGAGAACCACCTAGTAC No data
Right 926120795 2:10240299-10240321 AGAGGCCCAGGGTCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926120781 Original CRISPR GTACTAGGTGGTTCTCGTGG GGG (reversed) Intergenic
No off target data available for this crispr