ID: 926121180

View in Genome Browser
Species Human (GRCh38)
Location 2:10241909-10241931
Sequence TGCCGCGGCGTGTACAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926121172_926121180 26 Left 926121172 2:10241860-10241882 CCATTTGTTGCGCAGGGAGTTCA No data
Right 926121180 2:10241909-10241931 TGCCGCGGCGTGTACAGAGAGGG No data
926121171_926121180 27 Left 926121171 2:10241859-10241881 CCCATTTGTTGCGCAGGGAGTTC No data
Right 926121180 2:10241909-10241931 TGCCGCGGCGTGTACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926121180 Original CRISPR TGCCGCGGCGTGTACAGAGA GGG Intergenic
No off target data available for this crispr