ID: 926126868

View in Genome Browser
Species Human (GRCh38)
Location 2:10277426-10277448
Sequence GTGGTGGACCAGATGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926126865_926126868 -10 Left 926126865 2:10277413-10277435 CCGTGGGGACTTGGTGGTGGACC No data
Right 926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG No data
926126856_926126868 17 Left 926126856 2:10277386-10277408 CCTTCGAGGGATGTTTAGGAGGC No data
Right 926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926126868 Original CRISPR GTGGTGGACCAGATGGAGGA CGG Intergenic
No off target data available for this crispr