ID: 926128684

View in Genome Browser
Species Human (GRCh38)
Location 2:10286865-10286887
Sequence CCATTGCCCTGAAGCCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926128684_926128697 23 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128697 2:10286911-10286933 GTGTGGGTGGCACCAGCAGTGGG No data
926128684_926128693 7 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128693 2:10286895-10286917 AGGAGGGGGTGCCGCAGTGTGGG No data
926128684_926128698 27 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128698 2:10286915-10286937 GGGTGGCACCAGCAGTGGGCTGG No data
926128684_926128692 6 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128692 2:10286894-10286916 AAGGAGGGGGTGCCGCAGTGTGG No data
926128684_926128690 -8 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128690 2:10286880-10286902 GGCAATGGGAAGTGAAGGAGGGG No data
926128684_926128699 28 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128699 2:10286916-10286938 GGTGGCACCAGCAGTGGGCTGGG No data
926128684_926128691 -7 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128691 2:10286881-10286903 GCAATGGGAAGTGAAGGAGGGGG No data
926128684_926128688 -10 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128688 2:10286878-10286900 AGGGCAATGGGAAGTGAAGGAGG No data
926128684_926128689 -9 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128689 2:10286879-10286901 GGGCAATGGGAAGTGAAGGAGGG No data
926128684_926128694 10 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128694 2:10286898-10286920 AGGGGGTGCCGCAGTGTGGGTGG No data
926128684_926128696 22 Left 926128684 2:10286865-10286887 CCACGGTGGCTTCAGGGCAATGG No data
Right 926128696 2:10286910-10286932 AGTGTGGGTGGCACCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926128684 Original CRISPR CCATTGCCCTGAAGCCACCG TGG (reversed) Intergenic
No off target data available for this crispr