ID: 926130238

View in Genome Browser
Species Human (GRCh38)
Location 2:10298399-10298421
Sequence CTGTAATTACAAATGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926130230_926130238 27 Left 926130230 2:10298349-10298371 CCCTAAGTCAGCGTCACCCATGC No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data
926130231_926130238 26 Left 926130231 2:10298350-10298372 CCTAAGTCAGCGTCACCCATGCT No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data
926130235_926130238 -1 Left 926130235 2:10298377-10298399 CCAGCAGCTGCATTTCTCCACTC No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data
926130234_926130238 0 Left 926130234 2:10298376-10298398 CCCAGCAGCTGCATTTCTCCACT No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data
926130232_926130238 11 Left 926130232 2:10298365-10298387 CCCATGCTATTCCCAGCAGCTGC No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data
926130233_926130238 10 Left 926130233 2:10298366-10298388 CCATGCTATTCCCAGCAGCTGCA No data
Right 926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926130238 Original CRISPR CTGTAATTACAAATGAAACT GGG Intergenic
No off target data available for this crispr