ID: 926130722

View in Genome Browser
Species Human (GRCh38)
Location 2:10302186-10302208
Sequence GAGCCAGGAGGCGCCGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926130709_926130722 22 Left 926130709 2:10302141-10302163 CCTCTCGAGGCAGGTGCAGGGGA 0: 1
1: 0
2: 2
3: 22
4: 193
Right 926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 179
926130713_926130722 -10 Left 926130713 2:10302173-10302195 CCCCCCTCCCCGAGAGCCAGGAG 0: 1
1: 0
2: 6
3: 49
4: 851
Right 926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 179
926130705_926130722 29 Left 926130705 2:10302134-10302156 CCTGGTTCCTCTCGAGGCAGGTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 179
926130704_926130722 30 Left 926130704 2:10302133-10302155 CCCTGGTTCCTCTCGAGGCAGGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926130722 Original CRISPR GAGCCAGGAGGCGCCGACCC TGG Intergenic
900988605 1:6087251-6087273 GAGCCAGGAGGCAGCCACCGAGG - Intronic
901633652 1:10659786-10659808 GAGGCAGGAGGCTCTGGCCCTGG + Exonic
902663023 1:17918526-17918548 GAGCCAGGAGAAGCAGACCTGGG - Intergenic
903678428 1:25081386-25081408 GAGACAGGAGGAGCCAAGCCTGG + Intergenic
904613867 1:31739416-31739438 GGGCCAGGAGGCACCGTTCCTGG + Exonic
911329463 1:96510446-96510468 GAGCCAGGAGGAGTTGAGCCTGG - Intergenic
913090051 1:115470461-115470483 GAGGAAGGAGGGGCCGAGCCAGG - Intergenic
917765560 1:178212773-178212795 GAGCCATGAGCCGCCGTGCCCGG + Intronic
919826565 1:201507291-201507313 GGGGCAGGAGTCGCCGACTCTGG + Exonic
919943991 1:202306821-202306843 GAGCCGGCAGGCTCAGACCCTGG - Intronic
920021227 1:202958111-202958133 GACCCCGGGGGCCCCGACCCAGG - Intronic
924772135 1:247087884-247087906 CAGCCAGGAGGGGAGGACCCAGG + Intergenic
1063193878 10:3721786-3721808 GAGCCAGGAGGCTCAGTCCTGGG + Intergenic
1065458932 10:25934975-25934997 GAGGGAGGAGGCGCCGAGTCTGG + Intronic
1071858371 10:89648217-89648239 GAGCCAGGTGGCTCAGACCCAGG + Intergenic
1073060631 10:100731397-100731419 GCTCCAGGAGGAGCCGGCCCAGG - Intergenic
1076337817 10:129720374-129720396 GAGCCAGGAGGGGCCGAGGCTGG - Intronic
1076371611 10:129959336-129959358 GAGCCCGCTGGCACCGACCCCGG + Intronic
1077319009 11:1932609-1932631 GACCCAGGAGGCCCCGGCTCTGG - Intronic
1078091684 11:8268226-8268248 GAGCCTGGCACCGCCGACCCCGG + Intronic
1082786983 11:57322692-57322714 GAGGAAGGAGGAGCCGGCCCAGG + Intronic
1083642123 11:64151146-64151168 GAGCCAGGTGGCGTCCACCCAGG + Intronic
1083890151 11:65591933-65591955 GCGTCAGGAGGCGCGGGCCCAGG - Intronic
1083994769 11:66266469-66266491 GAGCGTGGAAGAGCCGACCCAGG + Exonic
1085294342 11:75422539-75422561 GAGCCAGGAGGCGGAGAGGCAGG - Exonic
1085308386 11:75501220-75501242 GTGCGAGGAGGGGCCGAGCCAGG - Intronic
1086863005 11:91947415-91947437 GAGTCAGGAGGGGCCACCCCTGG + Intergenic
1092239571 12:6828635-6828657 GAGCCAGGCGGCGCTGGGCCGGG + Exonic
1094818172 12:34206046-34206068 GACCCAGAAGGCGCAGGCCCAGG + Intergenic
1095371343 12:41470828-41470850 GAGCCAGGAGGTACAGTCCCTGG + Intronic
1096520446 12:52181807-52181829 GAGCCAGCAGACACCCACCCTGG - Intronic
1096967119 12:55637322-55637344 GAGCCAGGAGGTACCCACCATGG - Exonic
1098757638 12:74386783-74386805 GAGCCAAAAAGCGCCCACCCTGG - Intergenic
1104090117 12:125509290-125509312 GCGCCAGGAAGCCCCGGCCCAGG - Intronic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1105405475 13:20128772-20128794 CAGCCAGGTGGCGCCGATTCCGG + Intergenic
1114452761 14:22837631-22837653 GGGCCTGAAGGCGCCGACGCGGG - Intronic
1122341023 14:101028570-101028592 GACCCAGCAGCCGCCTACCCTGG - Intergenic
1122418426 14:101561138-101561160 GAGCCAGGCGGCGGGGACCAGGG + Intergenic
1122602977 14:102930412-102930434 GAGGCACGAGGCGGCGGCCCCGG + Exonic
1122824476 14:104362914-104362936 GAGGCACGGGGTGCCGACCCAGG - Intergenic
1124251130 15:28107031-28107053 GGGTCACGAGGCGCCGGCCCCGG + Intergenic
1124358336 15:29015809-29015831 GGGCCAGGAGGCAGGGACCCTGG + Intronic
1125142305 15:36422723-36422745 AAGTCAGGAGGCGCCAAGCCAGG + Intergenic
1125723512 15:41856556-41856578 CAGCCACGAGGCTCTGACCCGGG - Exonic
1127588415 15:60398588-60398610 GGGCCAGGAAGCCCCGAGCCTGG + Intronic
1129156577 15:73721951-73721973 GACCCAGGAGGCTCTGCCCCCGG + Intergenic
1129330417 15:74824232-74824254 GAGCCAGGACGCCCCAAGCCTGG + Intronic
1129454144 15:75667524-75667546 GAGCCAGAGGACGCGGACCCTGG - Intergenic
1129456295 15:75677607-75677629 GAGACAGGAGCTGCTGACCCTGG + Intronic
1129736734 15:77970718-77970740 GAACCAGGAGGCTCTGGCCCAGG - Intergenic
1129828541 15:78651773-78651795 GAACCAGGATGCCCCCACCCTGG + Intronic
1129849341 15:78782915-78782937 GAACCAGGAGGCTCTGGCCCAGG + Intronic
1130252957 15:82312838-82312860 GAACCAGGAGGCTCTGGCCCAGG - Intergenic
1130296900 15:82653671-82653693 GAGCCAGGAGAAGCCAACTCAGG + Intergenic
1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG + Intronic
1132642351 16:983613-983635 GGGCCAGGAGGCTCTGACCAGGG - Intronic
1132702084 16:1226272-1226294 GAGCCACGAGTCCCCGGCCCAGG + Intergenic
1132871738 16:2118486-2118508 GAGCCAGGAGGAGCAGAACCCGG - Intronic
1132874604 16:2130740-2130762 GGGACAGCAGGCGCAGACCCCGG - Intronic
1134520791 16:14918409-14918431 GAGCCAGGAGGAGCAGAACCCGG + Intronic
1134550786 16:15137564-15137586 GAGCCAGGAGGAGCAGAACCCGG - Intronic
1134553547 16:15149573-15149595 GGGACAGCAGGCGCAGACCCCGG - Intergenic
1134708463 16:16317060-16317082 GAGCCAGGAGGAGCAGAACCCGG + Intergenic
1134715678 16:16357093-16357115 GAGCCAGGAGGAGCAGAACCCGG + Intergenic
1134951139 16:18351585-18351607 GAGCCAGGAGGAGCAGAACCCGG - Intergenic
1134959079 16:18395066-18395088 GAGCCAGGAGGAGCAGAACCCGG - Intergenic
1137733914 16:50710428-50710450 GAGCCAGCGGGCGCCCATCCTGG - Intronic
1138591416 16:58001341-58001363 GAGCCGGGAGGGGCGGAACCCGG - Intronic
1139392698 16:66615035-66615057 CAGCCAGGGGACGCCCACCCAGG + Exonic
1139406491 16:66723043-66723065 GAGTCAGGCGGAGCTGACCCAGG - Exonic
1141703433 16:85652608-85652630 GAGAGGGGAGGCGCCGGCCCGGG + Intronic
1141727602 16:85799913-85799935 GAGCCTGGAGCCACCGAGCCCGG - Intronic
1142274740 16:89112021-89112043 GAGCCAGGAGCCTCCGCCACGGG + Intronic
1142647517 17:1324325-1324347 GAAGCAGGAGGCGATGACCCCGG - Intergenic
1142815288 17:2420290-2420312 GAGCCAGGAGTCCCTGTCCCAGG - Exonic
1142876313 17:2853705-2853727 GAGCCGGGAGCCGCCGGCCCGGG + Intronic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1143646677 17:8234841-8234863 GAGCCAGGAGTTGCAGTCCCAGG + Exonic
1145249512 17:21289585-21289607 GCGCCAGGAGGCGCGGACAAGGG - Intronic
1145819845 17:27823876-27823898 CAGCCAGGAGGCCCCCAGCCAGG - Intronic
1148206780 17:45784388-45784410 GGGCCGGGAAGCGCCGAGCCGGG + Intronic
1148551324 17:48552209-48552231 GAGCCAGGCGGGGCCGACAGGGG + Exonic
1148860207 17:50600664-50600686 GAGCCAGGAGCCGGGGAACCTGG + Intronic
1148954349 17:51341604-51341626 TAGCCAGAAGGAGCCCACCCAGG - Intergenic
1150255567 17:63741687-63741709 GAGCCAGGAGGGACTGGCCCCGG + Intronic
1150576337 17:66434021-66434043 GAGCCAGGAGCAGCAGAGCCAGG + Intronic
1151797049 17:76353486-76353508 GAGCTAGGCGCCGCCGCCCCCGG + Intronic
1152029123 17:77830805-77830827 GAGCCAGGATGTGCCGAGCTGGG - Intergenic
1152360808 17:79832298-79832320 GGGCCAGGAAGCCGCGACCCGGG - Intergenic
1152447944 17:80356667-80356689 GAGGCGGGAGCCGCCGAGCCTGG - Intronic
1152795405 17:82303951-82303973 GAGCCAGGAGGAGGTGGCCCCGG - Intergenic
1153314784 18:3711079-3711101 GAGCCAGGAGGGGCCGCCCTGGG + Intronic
1155507504 18:26547954-26547976 GAGCGAGAAGGCGCAGAGCCCGG - Intronic
1160631203 18:80247409-80247431 GGGCCTGGGGGCGCCGCCCCCGG - Exonic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1162532163 19:11242233-11242255 GAGCCAGGAGGCTCCCAGGCAGG - Intronic
1162733747 19:12734399-12734421 GCGGCAGGAGGAGCCGCCCCCGG - Exonic
1162899366 19:13785403-13785425 GAGCCAGGAGCCCCAGACTCCGG + Intergenic
1162951232 19:14073139-14073161 GAGCCAGGCAGAGACGACCCTGG + Exonic
1164498722 19:28793735-28793757 GAATGAGCAGGCGCCGACCCCGG - Intergenic
1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG + Intergenic
1165069815 19:33248797-33248819 GAGCCAGGAGGGACCAACCCAGG + Intergenic
1165339989 19:35204556-35204578 GAGGCAGGAGGCCACGAACCTGG + Intergenic
1166746609 19:45144865-45144887 GAGCCTGGAGACGCTGAACCTGG + Exonic
1167008113 19:46788375-46788397 GATCCGGGAGGCGGGGACCCGGG + Exonic
1167437816 19:49490063-49490085 GAGCCTGGAGTCCCCAACCCTGG - Intronic
1168422351 19:56212884-56212906 GAGCCATGAGGGGCAGTCCCTGG - Intergenic
926088728 2:10036445-10036467 GAGCCAGGGGGCACTTACCCAGG - Intergenic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
926887026 2:17607185-17607207 GAGCCAGGAGGCCCTGAACTTGG + Intronic
929452540 2:42047409-42047431 GAGCGAGGAGCCGCCACCCCCGG + Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
934502978 2:94873681-94873703 GAGCCAGCAGGGGCTGCCCCAGG + Intronic
934763732 2:96869398-96869420 GAGCCGGGCCGCGCCGTCCCCGG - Intronic
935433612 2:103004348-103004370 GGGCCCAGAGGCGCTGACCCAGG - Intergenic
941080520 2:161055441-161055463 GAGCCAGGAGGTGCAGAGCTTGG + Intergenic
947518807 2:230828678-230828700 GAGCCAGGCGGCGGCGCCCCAGG + Intergenic
947926361 2:233925690-233925712 GAGCCAGGAGGAGGGGACTCAGG + Intronic
1169170036 20:3457516-3457538 GAGCCAGGATTCCCGGACCCAGG - Intergenic
1170578690 20:17682272-17682294 AAGGCAGGAGGCGGCGATCCCGG - Exonic
1170968375 20:21096545-21096567 CAGACAGGAGTCTCCGACCCTGG + Intergenic
1173652998 20:44679245-44679267 GAGAGAGGAGGCCCCGATCCTGG + Intergenic
1173943517 20:46932204-46932226 GAGCCTGGAGGTGCAAACCCGGG - Intronic
1174365345 20:50053261-50053283 GAGCCAGGCGGCGGCGGCCCTGG - Intergenic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1178914741 21:36699956-36699978 GAGCCCGGCGGCCCCGGCCCAGG + Intronic
1180094636 21:45550238-45550260 CAGGCAGGAGGCGCCTCCCCAGG - Intergenic
1180801608 22:18634546-18634568 GGGCCTGGAGGCGGCGACCAGGG - Intergenic
1180852852 22:19030085-19030107 GGGCCTGGAGGCGGCGACCAGGG - Intergenic
1180983085 22:19888521-19888543 GAGCAAGGAGGCAGCGCCCCAGG + Intronic
1181220114 22:21360715-21360737 GGGCCTGGAGGCGGCGACCAGGG + Intergenic
1182351462 22:29702400-29702422 GAGCCAGGCAGCGCCTCCCCAGG + Intergenic
1183307376 22:37089820-37089842 GAGCCAGAAGGAGGGGACCCTGG + Intronic
1183639553 22:39084700-39084722 GAGGCAGGAGAGGCCGACCAGGG + Intronic
1184037198 22:41924089-41924111 TAGGCAGGAGGCGCCGGGCCTGG - Intergenic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1185412865 22:50695104-50695126 GAGCCAGGAGGAGCCAGCACCGG + Intergenic
950546376 3:13640389-13640411 GAGCTAGGTGGAGCCAACCCCGG - Intergenic
953143376 3:40249910-40249932 GAGCCAGGTGGCCCCGGGCCAGG + Intronic
954451252 3:50572884-50572906 GAGCCAGAGGGCGCAGACCAGGG + Intronic
963067357 3:141274263-141274285 GGGCCTGGAGGAGCAGACCCCGG - Intronic
967100360 3:186210754-186210776 GGGCCAAGAGGAGCCCACCCTGG + Intronic
968438709 4:610492-610514 GAGCCAGGAGGGACCACCCCAGG + Intergenic
969412921 4:7041735-7041757 GACCCAGGAGGACCTGACCCAGG - Exonic
969722241 4:8898516-8898538 GAGGCAGGAGGAGCCAAACCCGG + Intergenic
970332693 4:15002524-15002546 GAGCCAGGGGGCACCGACTTCGG - Intergenic
973601283 4:52545263-52545285 AAGCCAGGAGGAGCAGACTCAGG - Intergenic
979728964 4:123998653-123998675 GAGCCAGGAGGCTCGGTCTCAGG + Intergenic
985475777 5:78284-78306 GAGGCAGGAGGCCCCTCCCCGGG + Intergenic
985655659 5:1130301-1130323 GAGACAGGAGGTGCCTGCCCAGG - Intergenic
986695954 5:10354154-10354176 TAGCCCCGAGGCCCCGACCCCGG - Intronic
989101815 5:37830429-37830451 GAGCCAGGGGCAGCTGACCCAGG + Intronic
989568675 5:42925279-42925301 GAGCCAGGAAGCCCACACCCTGG + Intergenic
998349365 5:141490978-141491000 GAGCCAGGAGGAGCAGAGCGAGG - Exonic
1004690215 6:17987247-17987269 GAGCCTGGAGACGGCGCCCCGGG + Intronic
1006089614 6:31620745-31620767 GAGACGGGAGGAGCCGAACCCGG + Exonic
1006787881 6:36679998-36680020 GCGCCAGGCGGCGGCGCCCCAGG - Intronic
1007390394 6:41547010-41547032 GCGCCAGGAGGAGCCGGGCCCGG + Intronic
1013177410 6:107689630-107689652 GAGTCAGGAGGAGCAGAGCCTGG + Intergenic
1013366312 6:109440800-109440822 GAACCGGGAGCCGCCCACCCGGG + Exonic
1014724953 6:124962583-124962605 GCCCCAGGAGTCGCAGACCCTGG + Exonic
1018389572 6:163331877-163331899 GAAACAGGCGGGGCCGACCCAGG + Intergenic
1018906479 6:168078962-168078984 CAGTCAGCAGGAGCCGACCCTGG - Exonic
1019542993 7:1559821-1559843 CAGCCAGGAGGAGCAGGCCCTGG + Intronic
1022328528 7:29355604-29355626 GAGCCAGGGTGCGCAGGCCCTGG + Intronic
1023289581 7:38655663-38655685 GAGCCAGGAGAAGCCGAAGCTGG + Intergenic
1024639450 7:51317110-51317132 CCGCCAGGAGGCGCCGGCCCCGG - Intergenic
1025177935 7:56811305-56811327 GAGACAGGAGGAGCTGAGCCTGG + Intergenic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1026936976 7:74263165-74263187 GAGCCGGGAGGCGGAGATCCAGG - Intergenic
1027055367 7:75046056-75046078 GAGGCGGCAGGCGCCGACCCCGG + Intronic
1030128864 7:106179892-106179914 AAGCCAGGAGGGTCCCACCCAGG - Intergenic
1032013555 7:128361612-128361634 GAGCCAGGAGGCGGCGCCGCTGG - Exonic
1033220395 7:139523636-139523658 GAGCCGGGAGCCGTGGACCCGGG - Intergenic
1033369733 7:140697128-140697150 GAGCCAGTCGGCGCCGGCGCGGG + Intronic
1035286231 7:157809206-157809228 GAGCCAGGAGGCTGTGACTCTGG + Intronic
1035286266 7:157809339-157809361 GAGCCAGGAGGCTGTGACTCTGG + Intronic
1037639570 8:20730500-20730522 GAGCCAGCAGGAGGAGACCCAGG + Intergenic
1039593611 8:38770889-38770911 GGGCCAGGAGCCGCGGAACCAGG + Intronic
1041008047 8:53514895-53514917 GGGCCTGGAGGCGCAGACACCGG + Intergenic
1042859043 8:73295027-73295049 CCGGCAGGAGGCGCCGAGCCGGG + Exonic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1049657661 8:143805872-143805894 CAGCCAGGAGGCGTCTGCCCAGG - Intronic
1049709673 8:144057876-144057898 GAGTCAGCAGGAGCCCACCCAGG - Exonic
1049726005 8:144146856-144146878 GAGCCAGGTGGTCCCGACCCAGG + Intergenic
1053537204 9:38937730-38937752 GAGACAGGAGGCTGAGACCCCGG - Intergenic
1054628931 9:67426200-67426222 GAGACAGGAGGCTGAGACCCCGG + Intergenic
1057613470 9:96567296-96567318 GCGCCAGGAGGCCCCTGCCCCGG - Intronic
1058866680 9:109167277-109167299 GAGCGAGGATGCGCAGACCGAGG - Exonic
1060544911 9:124453930-124453952 GAGCCAGGACGCACGGCCCCGGG - Intronic
1060657405 9:125381361-125381383 CAGGCATGAGGCACCGACCCCGG - Intergenic
1060791809 9:126490193-126490215 GAGCCAGGCAGCTCCCACCCTGG - Intronic
1060925550 9:127452819-127452841 GAGCCAGGAGGCAATCACCCAGG - Intronic
1061817255 9:133204820-133204842 GAGCAAGGCAGAGCCGACCCTGG - Intergenic
1062122714 9:134842297-134842319 GGGCTAGGAGCCGCCGAGCCCGG + Exonic
1062319310 9:135982668-135982690 CAGCCAGGAGGAGCGGTCCCGGG + Intergenic
1062461789 9:136665467-136665489 GAGCCAGGAGAGGCCGCCCAGGG - Intronic
1185736594 X:2500758-2500780 GAGCCAGCCCGCGCCCACCCGGG + Intronic
1195065398 X:101234529-101234551 GAGGCAGGAGGGGCTGAGCCAGG - Intronic