ID: 926132590

View in Genome Browser
Species Human (GRCh38)
Location 2:10313726-10313748
Sequence CTCTGTCAGCTCTGCAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926132590 Original CRISPR CTCTGTCAGCTCTGCAATTC AGG Intronic
901406955 1:9055654-9055676 CTCTGTCATCTCAGCACTTGGGG + Intronic
903808020 1:26019269-26019291 ATCTGTCATCTCAGCAATTTGGG - Intergenic
905167839 1:36093485-36093507 CTCAGTCAGCTCCACAATGCAGG - Exonic
906169564 1:43712971-43712993 CTTTGTCAGCTTTGCCTTTCAGG + Intronic
906945094 1:50288609-50288631 CTCTGTCACCACCTCAATTCAGG + Intergenic
907447812 1:54520139-54520161 CTTTGCCAGCTCTGCAACCCTGG + Intergenic
908532450 1:65046693-65046715 CTCTCACAGCTCTGAAATTCTGG + Intergenic
908918437 1:69160632-69160654 CTCTGAAAGCTATGCAATCCTGG + Intergenic
909191434 1:72557519-72557541 TTCATTCAGCTTTGCAATTCTGG + Intergenic
909802077 1:79822335-79822357 CTCTTTCAGCTCTGCCATCTGGG + Intergenic
915449543 1:155995006-155995028 TACTGTGAGCTCTGGAATTCAGG + Intronic
916607148 1:166354194-166354216 CACTGTAAGCTCTGCCATACAGG - Intergenic
917335791 1:173923296-173923318 CTCTGCTAGCTTTGCAATTTGGG - Intergenic
919727507 1:200893823-200893845 CTCTGTCATCCCTGCACTTGGGG + Intronic
922244727 1:223784741-223784763 CTCTGTCTGCTCTGAATTTTGGG - Intronic
923468018 1:234266394-234266416 CTTTGTTAGTTCTGCCATTCTGG - Intronic
924921148 1:248630478-248630500 CTCTGACAGCTCTTCAACTCAGG + Intergenic
1066299602 10:34085233-34085255 ACCTTTCAGCTCTGCAATGCTGG + Intergenic
1066333797 10:34455346-34455368 ATTTTTCAGCTCTGCAATTATGG + Intronic
1067078343 10:43200591-43200613 CTCTTTCAGCACAGCACTTCAGG - Intronic
1069685374 10:70314763-70314785 TCCTGTCAACTCTGCAAGTCAGG - Intronic
1070011618 10:72480723-72480745 CTGTGTCACCTCTGTAATTGTGG - Intronic
1070162706 10:73875193-73875215 CTCTTTCATCTCTGCAGTTATGG - Intergenic
1070167631 10:73910847-73910869 TTCTCTCCTCTCTGCAATTCGGG + Exonic
1070271574 10:74961680-74961702 CTCTGGCAGGTCTTCAATCCGGG - Intronic
1073266166 10:102229863-102229885 AGGTGTCAGCTCTGCTATTCAGG - Intergenic
1074436263 10:113436841-113436863 CTTTTTCAGCTCTGCATCTCTGG + Intergenic
1075359570 10:121818179-121818201 CACTGTAAGCTCTGCCTTTCAGG - Intronic
1075360791 10:121831505-121831527 AACTGTCAGCTCCGCAAGTCAGG + Intronic
1076872424 10:133200507-133200529 CTCTGTGCTCTCTGCAATGCGGG + Intronic
1077336724 11:2008524-2008546 CTCTCACAGCTCTGCAAGCCAGG - Intergenic
1079548553 11:21665960-21665982 CTCTGTTAGCTCTTGACTTCAGG - Intergenic
1080480649 11:32646250-32646272 CTCTGTCAGCTATACAAATTAGG + Intronic
1081428591 11:42951384-42951406 GACTAGCAGCTCTGCAATTCAGG - Intergenic
1081635128 11:44716008-44716030 ATCTGTGAGCTCTGCAAACCAGG + Intergenic
1081688928 11:45062491-45062513 CTGTGTCTGATCTTCAATTCAGG + Intergenic
1081749640 11:45500755-45500777 CCCTGCCAGCTCTGCACTTCTGG + Intergenic
1082626914 11:55497253-55497275 CTCTTTCAGCTCTGCCACCCAGG - Intergenic
1084655039 11:70510172-70510194 CTCTGCCATCTCTGCAGGTCTGG - Intronic
1084797826 11:71519777-71519799 CACTGCCAGCTGTGCCATTCCGG - Intronic
1084806105 11:71580066-71580088 GTCTGTCATCCCTGCAATTTGGG - Intronic
1086911928 11:92482645-92482667 CCCTCTCAGCTCTGCAGTTCTGG + Intronic
1088260261 11:107936973-107936995 CTCTGTTACCTATGCAATTATGG - Intronic
1088422022 11:109658925-109658947 CACTGTAAGCTCTGCCTTTCGGG + Intergenic
1089305416 11:117523396-117523418 CTCTGTCTGCTCTGCTGTCCAGG + Intronic
1090392550 11:126398519-126398541 CACTGGTAGCTCTGCAGTTCTGG + Intronic
1090578129 11:128131151-128131173 CTCTGTCAGCCTTGCTTTTCTGG - Intergenic
1090879480 11:130821019-130821041 CTCTCTCAGCTCAGCTTTTCAGG + Intergenic
1090943806 11:131411755-131411777 CTCTTTGTGCTCTGCAAATCTGG - Intronic
1091206111 11:133822342-133822364 CACTGTCTGCTCTGAAATTTTGG - Intergenic
1202819708 11_KI270721v1_random:63706-63728 CTCTCACAGCTCTGCAAGCCAGG - Intergenic
1097066388 12:56323709-56323731 CTCTGTCAGCACTGCCATCCAGG - Intronic
1099921213 12:88959303-88959325 CTCCATCAGCTCTACCATTCTGG + Intergenic
1100531914 12:95468927-95468949 CTCTGTCCGCTCTGCCTTCCAGG + Intergenic
1101507162 12:105358105-105358127 ATCTGTAATCTCAGCAATTCAGG - Intronic
1101752635 12:107595245-107595267 CTCTTTCAGCACTGACATTCTGG + Intronic
1102171939 12:110848897-110848919 CTCTTTCAGCCCTGGAATTTGGG - Intronic
1102459593 12:113092208-113092230 CACTGTCAGCTGTGCAATCCTGG - Intronic
1103213515 12:119183843-119183865 CTCTGTCTGCTCTGAAAATAGGG - Intronic
1103573973 12:121863277-121863299 CCCAGCCAGCTCTGCATTTCTGG + Intronic
1104987519 12:132605179-132605201 CTCTGCCAGCTGTGCAATCCTGG - Intronic
1107289006 13:38830797-38830819 CTGTGTCAGCTCTCCATCTCGGG + Intronic
1110007797 13:70294088-70294110 AGCTGTCAGATCTACAATTCTGG - Intergenic
1112864115 13:103872414-103872436 AGCTGTCAGTTCTGCCATTCTGG + Intergenic
1113662767 13:112118397-112118419 CTCTGTCATCTCTGCTGTGCTGG + Intergenic
1115407730 14:33037383-33037405 GTCTGTCATCTCAGCAATTTGGG + Intronic
1116984729 14:51206441-51206463 CTCTCTGATCTCTGTAATTCAGG + Intergenic
1118632508 14:67718623-67718645 CTCTGTCATCACTGAACTTCAGG + Intronic
1120361724 14:83513078-83513100 CTTTGTCAGCTATACATTTCAGG - Intergenic
1121870444 14:97402220-97402242 CTAGGTCAGCACTGCAATCCAGG - Intergenic
1124027078 15:25976728-25976750 CTCTTTCAGCTCTGCCATCTGGG + Intergenic
1124954957 15:34354287-34354309 CTCTGTAAGCTCAGCAATCTGGG - Intronic
1125056368 15:35362348-35362370 TTCTGTCAGCACTCCAAGTCAGG + Intronic
1125769789 15:42157489-42157511 CTCTGTCACCTTTGCGTTTCTGG - Intergenic
1126032075 15:44508792-44508814 CCCTGTCAGCTGAGCTATTCGGG + Intronic
1126380045 15:48037100-48037122 CTCTGACATCTCTGTATTTCAGG - Intergenic
1128918872 15:71592783-71592805 CTCAGTCAGCACTGAAACTCAGG - Intronic
1129601017 15:76998210-76998232 CTCTGTCAGCTCTGTCACCCAGG - Intronic
1130086565 15:80782483-80782505 CCCTTCCAGCTCTGCATTTCAGG + Intronic
1130320673 15:82838144-82838166 CTCTGGCAGCTCTGCATTAAAGG + Intronic
1130787347 15:87114768-87114790 CTCTTTCACCTCTGCCATCCGGG - Intergenic
1132179902 15:99744347-99744369 CTCTGTCACATCTGCCATCCTGG - Intergenic
1137043124 16:35631957-35631979 CTTTGTCAGCTATGTTATTCAGG + Intergenic
1138898887 16:61244418-61244440 CGCTGGCAGCTCAGCAAATCGGG + Intergenic
1140024465 16:71272393-71272415 TTCTGTAAACTCTGCAATTAAGG - Intergenic
1142107577 16:88313691-88313713 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107580 16:88313727-88313749 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107582 16:88313763-88313785 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107584 16:88313799-88313821 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107590 16:88313901-88313923 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107597 16:88314003-88314025 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107603 16:88314105-88314127 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107606 16:88314141-88314163 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107609 16:88314177-88314199 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107618 16:88314315-88314337 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107625 16:88314417-88314439 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107628 16:88314453-88314475 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107635 16:88314555-88314577 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107639 16:88314627-88314649 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107647 16:88314729-88314751 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107655 16:88314831-88314853 GACTGTCATCTCTGTAATTCAGG + Intergenic
1142107663 16:88314933-88314955 GACTGTCATCTCTGTAATTCAGG + Intergenic
1143535836 17:7538838-7538860 CTTTTTCAGCTCTGCCATCCAGG - Intergenic
1146928365 17:36760729-36760751 CTCTTCCAGCTCTGACATTCTGG + Intergenic
1151189683 17:72389080-72389102 CTCTGGCCGCTCTGCACTCCTGG + Intergenic
1151416993 17:73973033-73973055 CTCTGTCTGCCCTGGGATTCAGG - Intergenic
1151632179 17:75318567-75318589 CTCTGTCTTCTCTCCACTTCTGG - Exonic
1153194434 18:2578473-2578495 CTCTGTCACTTCAGCAGTTCAGG - Intronic
1153368481 18:4286512-4286534 CTCCTTCTGCTCTGAAATTCTGG - Intronic
1154396606 18:13996588-13996610 CTATGTCATCTCTGCAACTTTGG - Intergenic
1157601484 18:48895676-48895698 GTCTGTAATCTCAGCAATTCAGG - Intergenic
1157819926 18:50759718-50759740 CTCTGGCAGTTCTGCAGTACAGG - Intergenic
1161959969 19:7517758-7517780 AGCTGTGAGCTCTGGAATTCAGG + Intronic
1162349306 19:10139105-10139127 CTGTATCAGCTCAGCAATTGAGG - Intronic
1162785804 19:13034000-13034022 CCCTGTCATCTCTGTACTTCGGG - Intronic
1162857593 19:13481234-13481256 CTTTGCCAGCTCTCCACTTCTGG - Intronic
1165604024 19:37083689-37083711 CTCTGTCAGCACGGAAAGTCTGG - Intronic
1167524903 19:49977562-49977584 CTCTGTCATCTCTGCTTTTCTGG - Intronic
1167910826 19:52700344-52700366 GTCTGTAATCTCTGCTATTCAGG + Intergenic
1168459262 19:56539616-56539638 CTCTTTCAGCTCTGCCTTCCAGG + Exonic
926132590 2:10313726-10313748 CTCTGTCAGCTCTGCAATTCAGG + Intronic
926161217 2:10490983-10491005 CTCAGCCAGCTCTGCACCTCTGG - Intergenic
926770444 2:16368511-16368533 CTCTGCCAGCTCTGCACAGCTGG + Intergenic
929875082 2:45790033-45790055 TCCTGCCAGCTCTGTAATTCAGG - Intronic
932703796 2:74008303-74008325 CTCTTTCACTTCTGCAAGTCTGG + Intronic
932738768 2:74275545-74275567 CTCTTCCACCTCTGCTATTCTGG + Intronic
932821981 2:74909280-74909302 CTCTTTCAGCTCTGCCGTCCAGG - Intergenic
932988077 2:76751492-76751514 CTCTGTCAGCACAGAAATTAAGG - Intronic
934810110 2:97270385-97270407 CTCTGTCAGCTCTAGAACTAAGG + Intergenic
934827582 2:97437554-97437576 CTCTGTCAGCTCTAGAACTAAGG - Intergenic
934969399 2:98750772-98750794 CTCTTTGAGCTCTGCCATCCTGG - Intergenic
935729826 2:106056118-106056140 CTCTTTCAGCTCTGCCGTCCGGG + Intergenic
936773323 2:115941410-115941432 CTCAGTGATCTCTGCAATGCTGG - Intergenic
937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG + Intronic
940785147 2:157972829-157972851 CTCTGTCAGCTCTGTCACCCAGG + Intronic
941989612 2:171542231-171542253 TTCTGTGAATTCTGCAATTCTGG - Intronic
944079772 2:195773941-195773963 CTCTCCAAGCTCTGCAGTTCTGG + Intronic
945263502 2:207867230-207867252 CTGTGGCAGCTCAGCTATTCAGG + Intronic
946317539 2:218927369-218927391 GCCTGGCTGCTCTGCAATTCAGG - Intergenic
946336112 2:219037715-219037737 CTCTGTCCTCTGTGCCATTCCGG - Intronic
948100387 2:235368232-235368254 CTATGTCAGCTCTGAAAATGTGG + Intergenic
948489985 2:238306461-238306483 GTCTGTCAGCACTGCCTTTCAGG + Intergenic
1170466687 20:16628706-16628728 CTCTCTCAGCTTTCCAATTTTGG + Intergenic
1173034103 20:39391892-39391914 CACTCTCAGTTCTGAAATTCTGG + Intergenic
1173207537 20:41006672-41006694 CGCTTTCAGCCCTGCCATTCAGG + Intergenic
1174102293 20:48136954-48136976 CTCTTTCAGCTCTGCTGTCCAGG - Intergenic
1174188283 20:48722395-48722417 CTCTGTCAGTTCACCTATTCTGG - Intronic
1174491321 20:50898414-50898436 CTGTGTCTGCTCTTCAATCCAGG + Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175964495 20:62653688-62653710 CTCTGTCATCTCCCAAATTCGGG + Intronic
1175969128 20:62675087-62675109 CTCTGTCCTCTCTGCAGCTCGGG - Intronic
1176012212 20:62904054-62904076 CTCTGGCAGCTTTTCAATTTTGG + Intronic
1176104657 20:63380293-63380315 CTCTTTCAGCCCTGCCATTTGGG - Intergenic
1178605152 21:34029817-34029839 CCTTGTCAGCTCTCCCATTCTGG - Intergenic
1178801619 21:35801095-35801117 CTCTGTAAAGTCTGCAATGCTGG - Intronic
1182041551 22:27242222-27242244 TCCTGTCAGCTCTGCTTTTCTGG + Intergenic
1182733579 22:32514389-32514411 CTCTTCCAGCTCTGACATTCTGG + Intronic
949828006 3:8183512-8183534 TTCTGTCAGCTCTGCAGTCGAGG + Intergenic
952589177 3:34930904-34930926 ATGTGTCAGCTGGGCAATTCTGG - Intergenic
953510938 3:43538527-43538549 CTATGGCAGCTTTGTAATTCTGG + Intronic
953687871 3:45092382-45092404 CTCTTTCAGCTTTGCAGTTCCGG - Intronic
954570363 3:51635971-51635993 CTCTGCCAGCTGTGCAGTTATGG + Intronic
956017110 3:64895338-64895360 GTCCTTCAGCTCTGGAATTCTGG - Intergenic
956103831 3:65796122-65796144 CTGTGCCAGCTCTGCAATTTTGG - Intronic
956127219 3:66022037-66022059 CTCTTTCCCCTCTGGAATTCAGG + Intronic
956749028 3:72331800-72331822 CTCTGGCAGCTCTCTGATTCTGG - Intergenic
957267039 3:77981466-77981488 CTCTGTCAGCTTTGGAAACCTGG - Intergenic
959810575 3:110614410-110614432 CTGGGTCAGCTTTACAATTCAGG - Intergenic
963273981 3:143312593-143312615 CTCTGTCAGCTGTGTAAAGCAGG - Intronic
965505410 3:169509853-169509875 CTCTGCCTGCTTTGCGATTCAGG + Intronic
966218905 3:177531098-177531120 CCTTCTCAGCTCTGCAAGTCCGG - Intergenic
966896282 3:184447640-184447662 CTCTGGCACCTCTGAAATCCAGG - Intronic
966938112 3:184727527-184727549 GACTGTCTGCTCTGCATTTCTGG + Intergenic
967539996 3:190656284-190656306 CTCTCTGAGCTCTGAAGTTCTGG - Exonic
971258389 4:25033620-25033642 CTCTGCCAGCTATGCTACTCTGG - Intergenic
975213852 4:71731319-71731341 CTTTTTCAGCTCTGCCATCCAGG - Intergenic
978121621 4:105086339-105086361 CTGTGTCTGGTCTTCAATTCAGG + Intergenic
978935629 4:114371715-114371737 ATCTGTCATCTCAGCAATTTGGG + Intergenic
979083912 4:116380775-116380797 TTCTGTTAGCTATGTAATTCTGG + Intergenic
979886014 4:126029160-126029182 CTCTGACAGCTGTGCATTACTGG + Intergenic
979942564 4:126779948-126779970 CTCTTTCAGCTCTGCTGTCCAGG - Intergenic
981597621 4:146445468-146445490 CTCCGTTAGCTCTGCCATCCAGG + Intronic
982646050 4:158026557-158026579 CTCTGTCAGCTGGAGAATTCTGG - Intergenic
982791162 4:159593161-159593183 CTCTGTCTGCACTGATATTCTGG + Intergenic
984962571 4:185112100-185112122 CTTTGGCAGATCTGCAATTTAGG - Intergenic
985561195 5:586943-586965 CACAGTCAGCTCAGCATTTCTGG - Intergenic
986163144 5:5249622-5249644 CTCTCTCAGCTCTGCCATCCAGG + Intronic
986549501 5:8936641-8936663 CTCTGGCAACTCTGAAAATCCGG + Intergenic
986558933 5:9041135-9041157 CTGTGTCATCTCTGTAAATCTGG + Exonic
987830770 5:23091661-23091683 GCCTGTAAGCCCTGCAATTCGGG - Intergenic
987932095 5:24414884-24414906 CTCTTTTAGCCCTGCCATTCAGG + Intergenic
989161243 5:38393786-38393808 CTCTTTCAGCTGTGCCATCCAGG + Intronic
989643997 5:43609521-43609543 CTCTGTTAGCGCTGGAAATCAGG - Intronic
992632421 5:78694831-78694853 CTTTGTCAGGTTTGCAACTCAGG + Intronic
994763299 5:103884093-103884115 CTCATTCAACTCAGCAATTCAGG - Intergenic
995871420 5:116747516-116747538 CTTTCTCAGCACTGGAATTCAGG - Intergenic
996056417 5:118988187-118988209 CTCGGGCAGCTCTGCGATTAGGG - Intronic
997445237 5:133935484-133935506 CTCTAGCAGCTCTATAATTCTGG - Intergenic
998589682 5:143464158-143464180 CACTGGTAGCTCTGCAATTCTGG + Intergenic
999436340 5:151566400-151566422 GGTTGTCAGCTCTGCAATTGTGG + Exonic
1000143735 5:158432634-158432656 GTCTGTCTCCTCTGCAGTTCAGG + Intergenic
1000694098 5:164358683-164358705 CTCTGGTAGCTCTACAGTTCTGG - Intergenic
1001812131 5:174636882-174636904 ACCTGTCACCTCTACAATTCAGG + Intergenic
1001834224 5:174817403-174817425 CTCTGTCAGCACTCCAAAACAGG + Intergenic
1004906080 6:20238530-20238552 CTCTTTTAGCTCTGCCATCCAGG + Intergenic
1006219169 6:32473471-32473493 CACTGTCAGCGCTGCCATGCGGG + Intergenic
1006452593 6:34113747-34113769 CTCTGACAGTGCTGCAAATCTGG + Intronic
1007735744 6:43981297-43981319 CTCTCCCAGCTCTGCTATCCTGG - Intergenic
1008070252 6:47092288-47092310 CTCTGTCTGCTCTGCACCACAGG - Intergenic
1011771413 6:90677677-90677699 CTCTGGCTGCACTGCAAGTCCGG - Intergenic
1012112809 6:95259109-95259131 CTCTTTTAGCTCTGCCATGCAGG + Intergenic
1015479132 6:133688872-133688894 ATCTGTCATCTCTGCAGTCCTGG + Intergenic
1019206483 6:170365953-170365975 CTCTGTCCCCTTTGCATTTCTGG - Intronic
1019549634 7:1595497-1595519 CTCTGTCAGCTCTGGAGATACGG + Intergenic
1019757880 7:2786991-2787013 CTCTGTCTGCTCTGCCCTCCAGG + Intronic
1020499857 7:8904019-8904041 CACTTCCAACTCTGCAATTCTGG - Intergenic
1021167564 7:17359879-17359901 CTCTTTTAGCTCTGCCATCCAGG + Intergenic
1021420390 7:20440038-20440060 CTCTTTCAGCTCTGCCATCCAGG - Intergenic
1021621558 7:22554973-22554995 CTCTCTCAGCCCTGCCATTCTGG + Intronic
1023103408 7:36741133-36741155 CACTGTCAGCTCTGAAACTTAGG + Intergenic
1023501208 7:40851494-40851516 TACTGCCAGCTCTGTAATTCTGG + Intronic
1024443480 7:49449350-49449372 CTCTCTCAGTTCTGGAATTTAGG + Intergenic
1024444705 7:49463493-49463515 CTATATCAGTTCTGCCATTCAGG - Intergenic
1025087347 7:56034168-56034190 ATCTGTCTGCTCTGCAAAGCCGG + Intronic
1029997207 7:105018190-105018212 CCCTAACAGCTCTGCATTTCTGG + Intronic
1030688410 7:112509159-112509181 CTCTTTCAGCTCTGCCGTCCAGG + Intergenic
1031357042 7:120799334-120799356 CTCTGTCAGATCTCCACTTACGG + Intronic
1033643698 7:143285568-143285590 CACTGGCATCTCTGGAATTCAGG - Intronic
1033880080 7:145870390-145870412 ATCTGTCATCTCAGCTATTCAGG + Intergenic
1034349876 7:150408638-150408660 CTCTTTCAACTCTGACATTCTGG - Intronic
1034998057 7:155590877-155590899 CTCTTTCAGCTCTGCTGTCCAGG + Intergenic
1036790779 8:11717801-11717823 AACTGTAAGCTCTGCAGTTCAGG + Intronic
1037452879 8:19034674-19034696 CTCTGTCCCTTCTGCAAGTCTGG - Intronic
1038277050 8:26130194-26130216 CGCTGAGAGCTCTACAATTCTGG - Intergenic
1041182413 8:55262669-55262691 CTCTCTCAGCTCTGGAAGCCGGG - Intronic
1041435212 8:57831795-57831817 CCCTGACACCTCTGGAATTCAGG - Intergenic
1041815191 8:61962450-61962472 ATGTGTCAGCTCTATAATTCAGG - Intergenic
1043237855 8:77891504-77891526 TTCTGTCAGCTCTCTAATACGGG + Intergenic
1043727427 8:83628893-83628915 CTCTGAATGCTCTGCAAATCTGG + Intergenic
1044252705 8:90022693-90022715 CTCTGTCAGCTCCTCATTTTTGG + Intronic
1044756485 8:95467855-95467877 CTCAATTAGCTCAGCAATTCTGG + Intergenic
1044775008 8:95678431-95678453 CTCAGCCAGCTCTGGACTTCTGG - Intergenic
1045010342 8:97953379-97953401 TACTGTCAGCCCTGCACTTCGGG + Intronic
1045571075 8:103370339-103370361 CTCTGTCCTCTCAGCAATCCTGG - Intergenic
1047822910 8:128540900-128540922 CCCTTTCAGCTCTGCAGCTCTGG - Intergenic
1047962337 8:130019590-130019612 CATTTTCAGCTGTGCAATTCTGG + Intergenic
1049140072 8:140946157-140946179 CTCTGACAGCTCTGTAAGTAGGG - Intronic
1050809992 9:9732822-9732844 CTCTGTCGTCTCAGCGATTCTGG + Intronic
1050989856 9:12136913-12136935 CTCTTTTAGCTTTGGAATTCAGG + Intergenic
1051478057 9:17530591-17530613 CTCAGTCAGTTCTGAAATTAGGG + Intergenic
1053667992 9:40330066-40330088 CTGTGTCAGCTCTGCTTTTCAGG - Intergenic
1053917800 9:42956352-42956374 CTGTGTCAGCTCTGCTTTTCAGG - Intergenic
1054379136 9:64470104-64470126 CTATGTCAGCTCTGCTTTTCAGG - Intergenic
1054516619 9:66046219-66046241 CTGTGTCAGCTCTGCTTTTCAGG + Intergenic
1055156158 9:73065597-73065619 CTCTTTCAGCTCTGCAGTCTGGG - Intronic
1056007079 9:82284264-82284286 CTCTGGCTGCTCTTCAATGCAGG - Intergenic
1056019464 9:82426312-82426334 TTCTGTGAGCTCTGGAAGTCAGG + Intergenic
1057304217 9:93903089-93903111 CTCTGTCAGGCCTGTCATTCAGG + Intergenic
1058878041 9:109261063-109261085 CTCTGGCAGCTCAGGAACTCTGG + Intronic
1059494782 9:114700384-114700406 CTCTTTTAGCTCTGCCATCCAGG - Intergenic
1061687014 9:132289514-132289536 CTTTGTCACCACTGCACTTCGGG + Intronic
1061855197 9:133438159-133438181 CCCTGCCAGCTCTGAGATTCTGG - Intronic
1061948373 9:133921376-133921398 ATCTGTCATCTCAGCACTTCAGG + Intronic
1187384335 X:18833499-18833521 CTCTTTCAGTTCTGCCATCCGGG - Intergenic
1188767938 X:34119868-34119890 CTGTGTCATCTCTAAAATTCTGG - Intergenic
1188952933 X:36399159-36399181 CTCTAACACCTCTGCAATCCTGG + Intergenic
1190069454 X:47267415-47267437 TTCTGTCACTTCTGAAATTCTGG + Intergenic
1190077376 X:47327653-47327675 TTCTGTCACTTCTGAAATTCTGG - Intergenic
1193073654 X:77332900-77332922 AGCTGTCATCTCTGCAGTTCAGG - Intergenic
1196368083 X:114945595-114945617 CTCTGACAGCTTTGTATTTCTGG - Intergenic
1196872539 X:120126407-120126429 CTTTGTCAGCACTAGAATTCTGG - Intergenic
1198652945 X:138883727-138883749 TTCTGTGAGCTCTGATATTCTGG - Intronic
1200266540 X:154649221-154649243 CTCTGTCTGCTCTCCACCTCAGG + Intergenic
1201236648 Y:11918397-11918419 CTCTGTCATCTCTGCTCATCAGG - Intergenic
1201305557 Y:12547015-12547037 CTCAGTGAGCTCTGCACTGCGGG + Intergenic