ID: 926133423

View in Genome Browser
Species Human (GRCh38)
Location 2:10319710-10319732
Sequence GGGAGCTCCACCAAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926133423 Original CRISPR GGGAGCTCCACCAAGGGGCC AGG (reversed) Intronic
900314835 1:2051368-2051390 GGGGGCTGCACCAGGTGGCCGGG + Intronic
900513501 1:3070854-3070876 GGGCGCCTCACCCAGGGGCCGGG - Intronic
900796594 1:4712092-4712114 GGGGGCTCCACACCGGGGCCGGG - Exonic
901325074 1:8360842-8360864 GGGAGGTCCCCAGAGGGGCCTGG + Exonic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902298412 1:15484147-15484169 TGGAGCTCCACAAAGGCCCCTGG + Intronic
902336078 1:15755796-15755818 GGGAGCTCCCCCATGGTGGCCGG - Intergenic
904007202 1:27369592-27369614 ACGAGCAACACCAAGGGGCCAGG + Intronic
904883464 1:33717860-33717882 GGGAGCTCCAGTAAGGGGGAAGG + Intronic
905858094 1:41328279-41328301 GGGAGGTCCAACAAGGAACCAGG + Intergenic
905968272 1:42117516-42117538 GGGAGATCAACAAAGGAGCCGGG + Intergenic
906689378 1:47782645-47782667 AGGAGCACCACCAAGGGGCAGGG - Intronic
908830582 1:68174555-68174577 CGCAGCTCCACCAAGGGTCATGG - Intronic
912209066 1:107538730-107538752 GGGAGCTCAACAATGGAGCCAGG - Intergenic
912710923 1:111949214-111949236 CGGAGATCCACCAAAGGCCCAGG - Intronic
913369663 1:118083960-118083982 GGGAGGAGCACCAAGGGTCCAGG + Intronic
915113346 1:153578992-153579014 GGGCGCTCCACCAAGGGCTTGGG - Intergenic
920440427 1:205977070-205977092 GGAAGGTACACCTAGGGGCCGGG - Exonic
922987868 1:229880433-229880455 GGGGGCTCCACCCAGGGCCCTGG + Intergenic
924290805 1:242534504-242534526 GGGATCTTCCCCAAGGGTCCTGG - Intergenic
924810996 1:247402027-247402049 GGAAGCTCCACCCAGGGGCTGGG + Intergenic
1063130332 10:3172561-3172583 GGGAGCTCCAGGAAGGGCTCGGG + Intronic
1065134961 10:22658967-22658989 TTGAGCTGCCCCAAGGGGCCTGG - Intronic
1065841289 10:29703559-29703581 GGGGGCTCCGACAAAGGGCCTGG + Intronic
1067037251 10:42929861-42929883 GGGAGGGCAAGCAAGGGGCCTGG - Intergenic
1067580765 10:47444108-47444130 GGGATGTCCACCATGGGTCCTGG - Intergenic
1067691226 10:48503647-48503669 GGGAGGTTCACCCAGTGGCCTGG - Intronic
1067777762 10:49175689-49175711 AGGAGCTCCTCCAAGGGGGCAGG + Intronic
1071532358 10:86400216-86400238 GGGAGCTGCACCATGCGGTCCGG + Intergenic
1072410274 10:95195696-95195718 GGGAGGGCCAGGAAGGGGCCTGG - Intronic
1072621312 10:97081314-97081336 GGGAGCCCCACCAACGTGGCAGG + Intronic
1073064469 10:100750022-100750044 GGGAGATCCCCAAAGGGGTCTGG + Intronic
1073156902 10:101354369-101354391 GGGAGCTCCAGAAAGGAGGCTGG + Intronic
1075705426 10:124497503-124497525 GGGAGCCCCACCCGGAGGCCTGG - Intronic
1075735903 10:124664425-124664447 GGGAGCTTCAACACTGGGCCGGG + Intronic
1076160750 10:128242772-128242794 CGGAATTCCACCAGGGGGCCTGG - Intergenic
1076488027 10:130836695-130836717 GAGATTTCCACCAAGGGGCAAGG + Intergenic
1076668449 10:132105740-132105762 GGCAGCTCCAGGAAGGGGCTGGG + Intronic
1077121827 11:912425-912447 GGGAGCTCTGCAGAGGGGCCTGG - Intronic
1078068614 11:8094128-8094150 GGCAGCTACAGCAGGGGGCCAGG + Exonic
1078929503 11:15902198-15902220 GGGAGCCCCAAGAAGTGGCCAGG - Intergenic
1079012480 11:16840713-16840735 GTGACCTCCATCAAGAGGCCAGG - Intronic
1083934238 11:65862091-65862113 GGGAGGTTCCCCGAGGGGCCTGG + Intronic
1084445672 11:69202218-69202240 AGGAGGACCACCTAGGGGCCTGG + Intergenic
1085026640 11:73240240-73240262 GGGGGCTCCACCCACGGCCCTGG + Intergenic
1085808307 11:79657269-79657291 GGCAGCTCCAGCATGGGGCTGGG - Intergenic
1087144792 11:94800572-94800594 GGGAGCTCTGCCTAGTGGCCTGG + Intronic
1090137257 11:124210604-124210626 GGGACCACCACGAAGGGGCTGGG - Intergenic
1091346036 11:134854834-134854856 GGGAGACCCACTGAGGGGCCAGG - Intergenic
1091698851 12:2646610-2646632 GGGAGCTCAAGCACTGGGCCAGG + Intronic
1091938145 12:4449955-4449977 GGGAGATCCACGCAGGTGCCTGG - Intergenic
1093524722 12:20093275-20093297 GGCAGCTCCACCTATGGCCCTGG - Intergenic
1094568174 12:31618575-31618597 GAGAGCTGCACAAAGGGGCTTGG + Intergenic
1096231698 12:49900409-49900431 GGGAGCTTTACCTCGGGGCCAGG - Intronic
1096256279 12:50064041-50064063 GGCAGCCCCACCCAGAGGCCTGG + Intronic
1096760376 12:53836720-53836742 GGGAGCTTCCCAGAGGGGCCTGG + Intergenic
1101909227 12:108850025-108850047 GGGAGCTCCAGGAAGGAGCTGGG + Intronic
1102246930 12:111361981-111362003 AGGAGCACCACCATGAGGCCTGG + Exonic
1102760027 12:115376985-115377007 GAGAGATCCACCATGTGGCCTGG + Intergenic
1103894421 12:124263686-124263708 GGCAGGACCACAAAGGGGCCAGG - Intronic
1103925676 12:124422374-124422396 GGCAGCTGGAGCAAGGGGCCAGG + Intronic
1104140831 12:125984289-125984311 GAGTCCTCCACCAAGGGGCGTGG - Intergenic
1104600605 12:130150837-130150859 GTGACCTGCACCAAGGTGCCTGG - Intergenic
1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1106626423 13:31425309-31425331 GGGAGAAACATCAAGGGGCCTGG + Intergenic
1107032898 13:35871265-35871287 AGGAGCACCACCAAGAGCCCAGG - Exonic
1109142392 13:58730642-58730664 AGCAGCTGCTCCAAGGGGCCAGG - Intergenic
1110404465 13:75134303-75134325 GAGAACTCCAGCAAGAGGCCAGG + Intergenic
1111333637 13:86792634-86792656 GGCAGCTCCACCCATGGCCCTGG + Intergenic
1113841886 13:113365208-113365230 GCGAGCGCCACCCAGGAGCCTGG + Intergenic
1113954311 13:114089057-114089079 GGGAGCTCCACCAGGGATTCGGG - Intronic
1114591218 14:23866489-23866511 GGAAGCTCCAGCAAGGAGCTGGG - Intergenic
1117837189 14:59819553-59819575 GGCAGCTCCACCCACGGCCCTGG - Intronic
1118558842 14:67056681-67056703 GGCAGCTCCACCCACGGCCCTGG - Intronic
1118971601 14:70642237-70642259 AGGAGCCCCAGCGAGGGGCCAGG + Exonic
1121492711 14:94371642-94371664 GGGAGCCCTCCCAAGGGGCGGGG - Intergenic
1121641243 14:95486146-95486168 GGGAGCTCTCCTCAGGGGCCAGG - Intergenic
1122740107 14:103867350-103867372 GGGAGCTCCAGCCAGGGCGCAGG - Intergenic
1122967488 14:105138104-105138126 GGAGGCTCCACAAAGGAGCCTGG - Intergenic
1123694572 15:22869123-22869145 GGGTGCTGCACAAAGGGACCGGG - Exonic
1126323375 15:47448512-47448534 CTGAGCTCCAACAAGGTGCCAGG - Intronic
1126997664 15:54462859-54462881 GGCAGCTCCACCCATGGGCCTGG + Intronic
1128131186 15:65228222-65228244 GGGAGCTTCACCCAAAGGCCAGG + Intergenic
1129269528 15:74412043-74412065 GGGAGTCCCACTGAGGGGCCAGG + Intronic
1129676236 15:77633559-77633581 GGCAGCTCTACCCAGGAGCCGGG + Intronic
1130300958 15:82679822-82679844 GGGAGCTCCACCGAAGCCCCAGG + Intronic
1130977667 15:88789693-88789715 TGGGGCTCCACCAAAGGTCCAGG + Intergenic
1131367514 15:91853285-91853307 CGCAGCGCCACCTAGGGGCCGGG + Intergenic
1132546129 16:534273-534295 GGGAGCTCCATCTGGGGGCCGGG - Intronic
1132602194 16:778370-778392 GGGAGGTCCACCAGGAGGCAGGG - Intronic
1134127623 16:11627223-11627245 AGGAGCTCCAGCAAGGGTCTTGG - Intronic
1134666440 16:16022282-16022304 AGGAGCCCCACCAAGCAGCCAGG - Intronic
1137585216 16:49660165-49660187 GGGAGCCCCCACAAGGTGCCTGG + Intronic
1138615044 16:58158462-58158484 GGGTTCTCCACCAAGTGGCATGG - Intronic
1139666897 16:68463670-68463692 GGGAGCTCCAGGAAGAGGCATGG - Intergenic
1141566122 16:84903228-84903250 GGGAGGTCCAGGAAGGGGCCAGG - Intronic
1141760784 16:86027117-86027139 GTCAGCGTCACCAAGGGGCCTGG - Intergenic
1141855014 16:86674774-86674796 AGGTGCTCCACCCAGGGGCATGG - Intergenic
1142234094 16:88913263-88913285 TCCAGCTCCACCAAGTGGCCGGG - Intronic
1143117979 17:4591333-4591355 GGGGGCTCCACCACGAGCCCAGG - Intronic
1145201816 17:20952307-20952329 GGGAGATCAACCAAAAGGCCTGG + Intergenic
1146560756 17:33867693-33867715 TGGAGCCCCACGAAGAGGCCTGG + Intronic
1147654440 17:42080798-42080820 GGAAGCTGCACCAGTGGGCCTGG - Intergenic
1149629653 17:58111917-58111939 GGGAGCTCCTCCCTTGGGCCAGG + Intergenic
1150376313 17:64684516-64684538 GAGAGTTCCACCAAATGGCCTGG + Intergenic
1152167849 17:78722508-78722530 GGCAGCTTCACCCAGGGGACAGG - Intronic
1152569722 17:81116375-81116397 GAGAGCCCCACCGAGGGGCATGG - Exonic
1155603287 18:27574270-27574292 GGCAGCTCCACAAATGGGGCTGG + Intergenic
1155890584 18:31263259-31263281 GGGAGGGCCACTAAGAGGCCTGG - Intergenic
1160159958 18:76463568-76463590 GCGAGAGCCACCCAGGGGCCTGG - Intronic
1161614249 19:5261150-5261172 GGGAAGGCCACCAAAGGGCCAGG - Intronic
1161698665 19:5783732-5783754 GGCAGCTCCACGAAGGCGGCGGG + Exonic
1162470864 19:10871461-10871483 GGGCGCTGCGCCACGGGGCCGGG + Intergenic
1162478323 19:10914078-10914100 AGGGCCTCCACCGAGGGGCCTGG - Intronic
1162724125 19:12679751-12679773 GGGAGCTGGACCAAGGGTCCTGG - Intronic
1163560036 19:18013696-18013718 GGGAGCTCCTCCAAGTACCCAGG + Exonic
1163584070 19:18154563-18154585 GGGAGCTCCATAGAGGGGTCAGG - Intronic
1165831005 19:38730309-38730331 AGGAGCATCAGCAAGGGGCCCGG - Exonic
1168151458 19:54451080-54451102 TGGAGCTCTACAAAGGGGCCAGG + Intronic
1168346636 19:55653044-55653066 GGCAGCTCCTCCGCGGGGCCAGG - Exonic
1168413936 19:56157100-56157122 GGGAGCCCCGCCAAGGGCCAAGG + Intronic
925688366 2:6495398-6495420 GGCAGCTCCCCGAGGGGGCCAGG - Intergenic
926133423 2:10319710-10319732 GGGAGCTCCACCAAGGGGCCAGG - Intronic
926133595 2:10320715-10320737 GGGAGCCCCACCAAGGTGCCAGG - Intronic
926563672 2:14445557-14445579 GGGAGCTCCACCCATGTGGCAGG + Intergenic
927515113 2:23667731-23667753 GCGTGCTCCACCCTGGGGCCCGG + Intronic
927645177 2:24872912-24872934 GGGTGGTCCACCCAGGGGCATGG + Intronic
927894666 2:26774127-26774149 GGGAGCCCCACTCTGGGGCCGGG + Intronic
928289671 2:30026323-30026345 AGGAGCTCCAGCAAGCTGCCCGG + Intergenic
932479829 2:72032552-72032574 GGGGCCCCCACCCAGGGGCCTGG + Intergenic
933129078 2:78650862-78650884 GGGAGCAGCATCAAGGGGCCAGG - Intergenic
934085190 2:88503501-88503523 GGCAGCTCCACCTAGGGCCCTGG + Intergenic
935710381 2:105893203-105893225 GGCAGCTCCACCGTGGGGCCCGG - Exonic
938977607 2:136494739-136494761 GGAAGGTGCACCGAGGGGCCTGG + Intergenic
939465202 2:142546467-142546489 GGCAGCTCCACCTACGGCCCAGG + Intergenic
945256061 2:207804257-207804279 GGTGGCTCCACCAAAGGGACAGG - Intergenic
948754170 2:240149631-240149653 GGGTCCTCGACCATGGGGCCAGG + Intergenic
948802028 2:240437330-240437352 GGGAGATCCACCAAGGGCAAGGG - Intronic
949011076 2:241678906-241678928 GGGAGGGCCTCCATGGGGCCTGG - Intronic
1169285150 20:4301589-4301611 GTGAGATCAACCAAAGGGCCAGG - Intergenic
1170930967 20:20768853-20768875 GGCAGCTCCACCCACGGCCCTGG + Intergenic
1172144914 20:32750208-32750230 GGGAGTTTCACCAAGGGGCCAGG + Intergenic
1174252485 20:49230164-49230186 GAGAGCCCCACCAGGCGGCCAGG - Intronic
1175729768 20:61346352-61346374 GGGAGCCCCAGCAAGGAGCTTGG + Intronic
1175826393 20:61938657-61938679 ATGAGCTCCACCAGGGGCCCCGG + Exonic
1178314788 21:31558942-31558964 GGGATCTCCGCGACGGGGCCGGG + Exonic
1179081783 21:38178365-38178387 CGCAGCTACACCAAGTGGCCAGG + Intronic
1179097015 21:38325045-38325067 GGGATCTGCACCATGGGGCAGGG + Intergenic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1179971146 21:44837154-44837176 GGGAGCTACACGGAGGTGCCGGG - Intergenic
1180985605 22:19902481-19902503 GGCAGGACCTCCAAGGGGCCAGG - Intronic
1181327554 22:22061414-22061436 GGAAGCCACACCAAGGGGGCTGG + Intergenic
1183075930 22:35426701-35426723 GGGAGCACCTCCCCGGGGCCAGG - Intergenic
1183605787 22:38866186-38866208 GGGGGCTCCACCAAGGAGGGGGG - Exonic
1184212607 22:43044834-43044856 CAGAGCTACACCATGGGGCCTGG - Intronic
1184505018 22:44895248-44895270 GGGGGCTTCCCCAAGGGGGCTGG + Intronic
950495639 3:13332798-13332820 GGGAGCTCCTTCAAGGAGCCTGG + Intronic
950533480 3:13566543-13566565 GTGAGCCACCCCAAGGGGCCTGG + Intronic
951491163 3:23271984-23272006 GGCAGCTCCACCCACGGCCCTGG - Intronic
952314621 3:32221858-32221880 GCCATCTCCACCAAGGTGCCAGG - Intergenic
953848631 3:46448837-46448859 GGGAGCTCCATCACAGGGGCGGG - Intronic
953853791 3:46485365-46485387 GGGAGCTCTTCTGAGGGGCCAGG - Intergenic
954305792 3:49724722-49724744 GGGATTCCCATCAAGGGGCCTGG - Exonic
954540623 3:51391240-51391262 GGGAGCGGCGCCGAGGGGCCGGG - Intergenic
954568744 3:51622802-51622824 AGGAGCTCCAGGAAGGGGACAGG + Intronic
960466044 3:117997437-117997459 GGGAGCGCAAGCCAGGGGCCGGG + Intergenic
961404666 3:126669469-126669491 GGGAGTTCCTTCAAGGAGCCTGG - Intergenic
961956968 3:130814795-130814817 GGCAGCTCCACCCACGGCCCTGG - Intergenic
962264274 3:133934461-133934483 GGGGCCTCTTCCAAGGGGCCAGG + Exonic
965652437 3:170947630-170947652 GGCAGCTCCACCCACGGCCCTGG + Intergenic
965660694 3:171038980-171039002 GGCAGCTTCACCAAGGAGCCAGG + Intergenic
965744141 3:171907008-171907030 GGCAGCTCCACCCACGGCCCTGG - Intronic
966425403 3:179775472-179775494 GGCAGCTCCACCCACGGCCCTGG - Intronic
966887895 3:184386788-184386810 GGGATCTGGAGCAAGGGGCCTGG + Intronic
968800896 4:2742755-2742777 AGGACTTCCACCAAGGGGCTGGG - Intronic
972679884 4:41295114-41295136 GACATCTCCTCCAAGGGGCCTGG + Intergenic
973135324 4:46699260-46699282 GGCAGCTCCACCCATGGCCCTGG + Intergenic
974838167 4:67275203-67275225 GGCAGCTCCACCCATGGCCCTGG - Intergenic
976707439 4:88034192-88034214 GGGAGCCAAACCAGGGGGCCTGG + Intronic
980739329 4:136929402-136929424 GGGAGCTCCACCTGCGGCCCCGG + Intergenic
983904507 4:173169442-173169464 GGAGGCTGGACCAAGGGGCCTGG - Intronic
987198090 5:15547571-15547593 GGTTGCTCCAGAAAGGGGCCTGG + Intronic
989342279 5:40389379-40389401 GGTAGGTCCAGCATGGGGCCTGG - Intergenic
998260980 5:140631868-140631890 TGGTGCTGCTCCAAGGGGCCCGG - Exonic
999194385 5:149772105-149772127 GGCGGCTCCTCCAAGGGTCCTGG - Intronic
999368603 5:151039060-151039082 GGGAGCCCAGCCAAGGGACCCGG + Intronic
1003366341 6:5478522-5478544 GGGAGCTCCAGCCAGGGTCTGGG - Intronic
1004362512 6:14983851-14983873 GGGAGCTACACCAACTGGCTGGG - Intergenic
1006392521 6:33766780-33766802 AGAAGCTCCACCCAGGGGCAGGG - Intergenic
1006406611 6:33849258-33849280 GGGAGCTCCTACAACGAGCCAGG + Intergenic
1006825175 6:36929392-36929414 GGGTGAGCCAGCAAGGGGCCTGG - Intergenic
1007097625 6:39223632-39223654 GGAGGCTCCACTCAGGGGCCTGG + Intronic
1007601331 6:43083461-43083483 GCCAGCTCCACCAAAGCGCCAGG - Intronic
1007830085 6:44631150-44631172 GCCAGCCCCACCCAGGGGCCAGG - Intergenic
1008844906 6:55950715-55950737 GGCAGCTCCACCCACGGCCCTGG + Intergenic
1010665823 6:78629191-78629213 GGGAGCTCCATCACGTGGCTGGG + Intergenic
1012131363 6:95497350-95497372 GGCAGCTCCACCCATGGCCCCGG + Intergenic
1012958116 6:105592584-105592606 GGGAGGACAACCAAGTGGCCAGG - Intergenic
1013342723 6:109230756-109230778 GTCAGCTTCACCAAGGAGCCTGG - Intergenic
1014088305 6:117373243-117373265 GGCAGCTCCACCCACGGCCCTGG - Intronic
1017383439 6:153856882-153856904 GGCAGCTCCACCCACGGCCCTGG - Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019696947 7:2451454-2451476 GGGAGCTCCTCTAAATGGCCCGG - Intergenic
1019768852 7:2870860-2870882 GGGAGCTCTAGCAAGGTCCCGGG + Intergenic
1020111172 7:5448594-5448616 GGGAATTCCAGGAAGGGGCCTGG + Intronic
1023186199 7:37535952-37535974 GGGTGCTCCACAAAAGGGTCTGG - Intergenic
1023846538 7:44123904-44123926 GGGGGCTTCACCAAGGAGGCTGG - Intronic
1024002337 7:45199049-45199071 GAGAGCTCCACCATGGGGATGGG - Intergenic
1024378724 7:48669551-48669573 GTGTGCTCCAAAAAGGGGCCTGG + Intergenic
1024608796 7:51045633-51045655 AGGGCCTCCTCCAAGGGGCCTGG - Intronic
1024786880 7:52918158-52918180 GCGAGCACCACCCAGTGGCCAGG + Intergenic
1026239073 7:68556117-68556139 GGGAGGTCCACCAAGGACCCAGG - Intergenic
1029012053 7:97272515-97272537 GGGAGCTCAACCAACGGGTGGGG + Intergenic
1029318200 7:99733678-99733700 GTGACCTCCACTAGGGGGCCAGG + Intronic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1029571587 7:101373230-101373252 CCGTGATCCACCAAGGGGCCAGG - Intronic
1029572373 7:101378813-101378835 GGGACATCCTCCAAGGGGCTGGG - Intronic
1029614602 7:101648413-101648435 GGGAGCCCCAGCATGGGACCTGG - Intergenic
1030351473 7:108493019-108493041 GGTGGCTCTACCAATGGGCCTGG - Intronic
1032983996 7:137316930-137316952 AGCAGTTCCACTAAGGGGCCTGG - Intronic
1034393364 7:150802169-150802191 GGCAGGTCCACCTAGGAGCCGGG + Intronic
1034973734 7:155436073-155436095 GGGAGGTCTACCAAGGTCCCAGG - Intergenic
1035294871 7:157861337-157861359 TGGAGCTCGGCCAAGGAGCCCGG + Intronic
1037818584 8:22124855-22124877 TGAAGATGCACCAAGGGGCCTGG + Intronic
1037821196 8:22135523-22135545 GCAAGCTCTGCCAAGGGGCCTGG + Intergenic
1038446789 8:27610183-27610205 GGGAGCTGGGCTAAGGGGCCTGG + Intronic
1039766491 8:40633705-40633727 GGGAGCTTCTCAAAGGGGACTGG + Intronic
1039785584 8:40831829-40831851 AGGAGCTCTCACAAGGGGCCAGG - Intronic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1042386434 8:68180633-68180655 GTGAGCACCAACAAGGTGCCAGG + Intronic
1042503797 8:69538447-69538469 GGTATCTCCAGAAAGGGGCCCGG - Intronic
1046027140 8:108738648-108738670 AGAAGCTCCATCAATGGGCCAGG - Intronic
1048397040 8:134023645-134023667 GAAAGCTCCACCAATGTGCCCGG - Intergenic
1048967385 8:139624675-139624697 GGCAGCCCCACCCAGGGGTCTGG + Intronic
1049108515 8:140628345-140628367 GGCAGCCCCACCAGGGAGCCAGG + Intronic
1049242009 8:141542793-141542815 GAGACCTCCAGCAAGGGGCCAGG - Intergenic
1049411136 8:142474508-142474530 GGCAGCAGCACCAGGGGGCCGGG - Intronic
1049412543 8:142479677-142479699 TGGGGCTCTGCCAAGGGGCCCGG - Exonic
1049553252 8:143270348-143270370 GGGGGCTCCCCCAAGGAGCCAGG + Intronic
1052896280 9:33750783-33750805 GGGAGCCCCGCCAAGGAGCGGGG + Intronic
1056498247 9:87181975-87181997 TGGAGCTCCAACTAGAGGCCTGG - Intergenic
1057179288 9:93021264-93021286 TGGAGCTGCCCCAAGGGCCCAGG + Intronic
1058567887 9:106306475-106306497 TGGAGCTCCACAAAATGGCCTGG + Intergenic
1059378137 9:113901634-113901656 GGAAGCTCCAGCCAGGGGACAGG + Intronic
1059732822 9:117073732-117073754 GGTAACTCCAGCAATGGGCCTGG + Intronic
1060213265 9:121723385-121723407 GGGAGCTCCTCCAGGGAGGCAGG - Intronic
1060930663 9:127487593-127487615 TTGATCTCCTCCAAGGGGCCTGG + Intronic
1061056324 9:128224727-128224749 GGGAGCTCCAGGGAGGGGTCTGG + Intronic
1062382536 9:136294442-136294464 GGCAGCTCCACCCCGTGGCCTGG + Intronic
1062442940 9:136579168-136579190 TGGAGCTCCACACTGGGGCCAGG + Intergenic
1185621472 X:1453367-1453389 CGGTGCTTCACCAAGCGGCCGGG - Intronic
1185713982 X:2326599-2326621 GGGAGCTCCACCAGGTTCCCAGG + Intronic
1186797387 X:13060025-13060047 GGGAGATCATCCAAGTGGCCTGG - Intergenic
1188587209 X:31792614-31792636 GCGAGTTCCACAAAGGGGTCAGG - Intronic
1190290825 X:48991030-48991052 GGGGGATCCCCCAGGGGGCCTGG - Exonic
1190822277 X:53985069-53985091 GGGAGCTCCAGCAGTGGGCTGGG - Exonic
1192249102 X:69396542-69396564 GGGGGCTTCACCAAGGAGCTGGG - Intergenic
1193951702 X:87808649-87808671 GGCAGCTCCACCTATGGCCCAGG - Intergenic
1200063389 X:153493748-153493770 GGGAGCTCTACCTGGGGGCATGG - Intronic
1200066371 X:153505983-153506005 CGGAGCTCCACCAGGGAGCTGGG - Exonic