ID: 926134256

View in Genome Browser
Species Human (GRCh38)
Location 2:10325587-10325609
Sequence CCTGCTAAGCAGGCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926134247_926134256 18 Left 926134247 2:10325546-10325568 CCTGCTCAGAGCAGGTTTCCAGC 0: 1
1: 0
2: 1
3: 25
4: 220
Right 926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181
926134249_926134256 -7 Left 926134249 2:10325571-10325593 CCTTCCTCGCCAGCATCCTGCTA 0: 1
1: 0
2: 3
3: 14
4: 201
Right 926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181
926134248_926134256 0 Left 926134248 2:10325564-10325586 CCAGCAACCTTCCTCGCCAGCAT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926134256 Original CRISPR CCTGCTAAGCAGGCCCTGGA GGG Intronic
902580266 1:17403624-17403646 TCTGCTATGCAGGCAATGGAGGG - Intergenic
904541764 1:31238535-31238557 CCTTCAAATCAGGCCCTGGCAGG - Intronic
905181884 1:36172359-36172381 CCTGCTACCCATGCCCTGGGTGG - Intronic
905315102 1:37077542-37077564 CCTGCTTCACAGCCCCTGGAGGG + Intergenic
905973109 1:42155716-42155738 CCAGCTGCTCAGGCCCTGGAAGG - Exonic
906523082 1:46478739-46478761 CCTCCCAAGCAGGCCATGGGAGG + Intergenic
912693382 1:111821524-111821546 CCTGCTCAGGAAGCCCTGGGTGG + Intronic
914900911 1:151710571-151710593 CTTGCAGAGCAGGCCCTGCAGGG + Intronic
915982202 1:160427241-160427263 CCTGGAAAACAGGGCCTGGATGG + Exonic
916040090 1:160954319-160954341 TCTGCTGTGCAGGGCCTGGAGGG - Intronic
917796233 1:178534652-178534674 CCTGCTCACCAGGCCTTGGTGGG + Intronic
918303527 1:183225490-183225512 CCTTCTAAGCAGGACTGGGAAGG + Intronic
920177617 1:204112937-204112959 TCTGCCCAGCTGGCCCTGGATGG + Exonic
922696395 1:227733153-227733175 CCTGCTGAGCAAGCCCTGCTGGG - Intronic
923105031 1:230847909-230847931 CCTGCTAAGAAGCCTCTAGAAGG + Intronic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
1062831974 10:611577-611599 GCTGCTAAAGAGGCCCTGGTGGG - Intronic
1063015319 10:2070877-2070899 CCTGCTGAGCAGGGCTGGGAGGG + Intergenic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1068894086 10:62180457-62180479 CCTGGGAAGCTGGCCCTGCAAGG + Intergenic
1070582085 10:77728909-77728931 CCTGCTGGGAAGGCCCAGGAAGG + Intergenic
1070766229 10:79058013-79058035 TCTGCTAAGCTGGCCCTAGCTGG - Intergenic
1074291841 10:112143495-112143517 CCTCCAAAGCATGCCCTTGAGGG + Intergenic
1077411286 11:2405079-2405101 CCAGCAAGGCAGGCCCAGGAAGG + Intronic
1077523681 11:3051160-3051182 CCTGCTAAGCAAGCCCCTGGGGG - Intronic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1079005225 11:16786799-16786821 CTTGCTTAGCAGGGCCTTGAAGG - Intronic
1080681687 11:34482743-34482765 CCTCCTAGGAAGGCCCTGCACGG - Intronic
1086070904 11:82797862-82797884 ACTGCTGAGCTGGCTCTGGAGGG - Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG + Intronic
1098888500 12:75984048-75984070 CCTGCTAGGCAGGCCGGGCATGG + Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1101947212 12:109146587-109146609 CCTGTGAAGCTGGCCCTGGTGGG - Intronic
1102159319 12:110755809-110755831 CCTGCTCAGCATCCCCTGGGAGG - Intergenic
1102469067 12:113149411-113149433 ACTGCTAGCCAGGCCCTGGGTGG - Intergenic
1102502049 12:113359373-113359395 CCTGCTGACCTGGCACTGGAAGG - Intronic
1102523518 12:113494298-113494320 CCTACGAAGCTGGTCCTGGAGGG + Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104855495 12:131900582-131900604 CCTGCCCAGCATGCCCTGGGAGG + Intronic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107886930 13:44881433-44881455 CTTGCTAAGCAGGCCTTTTATGG - Intergenic
1112227834 13:97558007-97558029 CCTGCTCAACATGCCCTGGCAGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1113902242 13:113803798-113803820 CCTGCCCAGCGGGCACTGGAAGG - Intronic
1114424583 14:22611406-22611428 GCAGTTAAGCAGACCCTGGATGG - Exonic
1115705253 14:35991502-35991524 CCTACTCAGCAGGCTCTGGCTGG + Intergenic
1119018693 14:71086497-71086519 CCTCCAAAGCAAGCCCTGAAAGG - Intronic
1124240349 15:28023154-28023176 GCTGCTCAGCAGGGCCTGGCAGG - Intronic
1124609840 15:31200941-31200963 CTTCCCCAGCAGGCCCTGGAGGG - Intergenic
1124693822 15:31847001-31847023 CCTGCTAGGCAGGGCAGGGAAGG + Intronic
1127514418 15:59677739-59677761 CCTGCTAACCAGTTCCTGGAGGG - Intronic
1127646947 15:60968232-60968254 CCTGCTGAGCTGACTCTGGAAGG + Intronic
1129287238 15:74535468-74535490 CCAGCTTAGCTGGGCCTGGATGG + Intergenic
1130101152 15:80895119-80895141 CCTGGTAAGCAGCCCCTTGTCGG + Exonic
1132550446 16:551859-551881 CCTGAAGAGCCGGCCCTGGAGGG + Intronic
1132630501 16:915006-915028 CCTGCTCGGCTGGCCCAGGAGGG + Intronic
1132806862 16:1778941-1778963 CCTGCTAGGCCAGCCCTGCAGGG + Intronic
1133844328 16:9440020-9440042 CTTGCTAAAGAGGCTCTGGAAGG + Intergenic
1134314820 16:13108909-13108931 GCTGCTCAGCACGCTCTGGAAGG - Intronic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1137609943 16:49811446-49811468 CCTGCTAAGCACACTCTGGGTGG - Intronic
1138100261 16:54246622-54246644 CTTGCCAAGCAGGCCTTGGGTGG - Intronic
1138615106 16:58158906-58158928 CTTGCTATGCTGGACCTGGAAGG - Intronic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142563053 17:822519-822541 CCTGCTAACCCGGCCTTGGATGG - Intronic
1143009297 17:3857189-3857211 GCTGCTGAACAGGCCTTGGAGGG + Intergenic
1143203341 17:5127072-5127094 ACTGCAAAGCAGTCCCTGGCTGG + Intronic
1143898704 17:10156995-10157017 CCTCCTAACCAGGCCTTGGTCGG + Intronic
1144874508 17:18390398-18390420 ACTGCAAAGCAGTCCCTGGCTGG + Intergenic
1145157723 17:20554023-20554045 ACTGCAAAGCAGTCCCTGGCTGG - Intergenic
1145825839 17:27876704-27876726 CTTGCAAAGAAGGCCCTTGAGGG + Intronic
1148850357 17:50551643-50551665 CCTGCTACACCGGCCCTGGGGGG + Exonic
1148895275 17:50835861-50835883 CCTGAGAAGAAGGCCCTGGTGGG + Exonic
1149549696 17:57531201-57531223 CCTTCACAGCAGCCCCTGGAGGG + Intronic
1149848654 17:60022077-60022099 ACTGCAAAGCAGTCCCTGGCTGG - Intergenic
1149861515 17:60124447-60124469 ACTGCAAAGCAGTCCCTGGCTGG + Intergenic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1151559580 17:74863080-74863102 GCTGCTGAGCAGGGCCTGGATGG + Exonic
1152281034 17:79384999-79385021 CCTCTGAACCAGGCCCTGGAAGG - Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152543522 17:80989287-80989309 CCTCCACAGCAGGCCATGGAGGG - Intergenic
1157479629 18:48045150-48045172 CCTGCTTGGCTGTCCCTGGAGGG - Intronic
1157601830 18:48897601-48897623 CCTGCTAAGAGGTTCCTGGAGGG - Intergenic
1158243000 18:55398567-55398589 CATGCTGTGCAGGCTCTGGAAGG - Intronic
1159314487 18:66753856-66753878 CCTGCTAAGCTGGGCCTGGATGG + Intergenic
1163177319 19:15573475-15573497 CCTGCTATGCTGGGCCTGGAGGG + Intergenic
1164418606 19:28067335-28067357 CTTGCCAAGGAGTCCCTGGATGG + Intergenic
1165752440 19:38268524-38268546 CCTGCCCAGCAGTCCCTGGCAGG + Intronic
1166343613 19:42152363-42152385 CCTGCCAAGAAGGCCCCAGATGG + Intronic
1166560743 19:43731032-43731054 TCTGCTAAGAAGTCCCTAGAAGG - Exonic
1168262956 19:55207185-55207207 CCAGCTGCACAGGCCCTGGAGGG + Exonic
925059777 2:881766-881788 CCTGCTCAGCAGGCACAGGCAGG + Intergenic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
926750002 2:16191111-16191133 CCAGCTAAGCAAGGCCGGGAAGG + Intergenic
932166654 2:69513987-69514009 TCAGGTAAGCAGGCCCTTGACGG + Intronic
932213770 2:69953011-69953033 CCCGCTGTGCAGCCCCTGGAGGG - Intergenic
933970578 2:87466802-87466824 CCTGCTGAGCTGGGCCTGAAAGG + Intergenic
935612122 2:105036753-105036775 CCTGCAAAGCTGTCCTTGGAGGG - Intergenic
936323151 2:111483380-111483402 CCTGCTGAGCTGGGCCTGAAAGG - Intergenic
939740825 2:145903277-145903299 CAAGCTAAGCAGGCAATGGATGG - Intergenic
942192472 2:173483736-173483758 CCTGCTCAGTAGACCCTTGATGG - Intergenic
943571663 2:189581392-189581414 CCTGCTATGCAGTCCGGGGAAGG - Intronic
944129795 2:196335429-196335451 GCTGATGGGCAGGCCCTGGAGGG + Intronic
945187647 2:207155952-207155974 CCTGCTAACTCGGCTCTGGAAGG + Intronic
946232200 2:218298637-218298659 CACACTAAGCAGGGCCTGGAGGG + Intronic
947593309 2:231396668-231396690 TCTGCTAGGCTGGCCCTGGAAGG + Intronic
948386104 2:237582034-237582056 CCTCCGCAGCAGGCCCTGGCGGG + Intronic
948436417 2:237956711-237956733 GCTGCCAAGCAGGGCCTGGCGGG - Intergenic
948869831 2:240792329-240792351 CCAGCCCAGCAGGCCCTGGGAGG - Intronic
1170614577 20:17938381-17938403 CATGGGAAGCAGGCCGTGGAAGG + Intergenic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1176012436 20:62906222-62906244 GCTGCCAAGCAGGCGCAGGATGG - Intronic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1176154385 20:63610911-63610933 CCTGCTAAGCACACCCAGGCAGG + Intronic
1176215629 20:63946379-63946401 CCTGCTCCACAGGCACTGGAGGG + Intronic
1176248915 20:64110807-64110829 CCAGCCAGGCAGGCCCTGGTAGG + Intergenic
1178511809 21:33211678-33211700 GCTGCTTCGCCGGCCCTGGAGGG - Intergenic
1179115696 21:38490023-38490045 ACTGCACAGCAGGTCCTGGAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183059406 22:35326955-35326977 GCAGCTAACAAGGCCCTGGAGGG - Intronic
1183168925 22:36170215-36170237 CTTGGGAAGCAGGTCCTGGAGGG - Intergenic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1184372334 22:44090372-44090394 GCTGCTGAGCAGTCCCTGGGCGG + Intronic
1184451505 22:44585541-44585563 CCTGCCCTGCAGGCCATGGAGGG + Intergenic
1184715963 22:46281963-46281985 CCTCCTGACCAGGCCCTGTAAGG - Intronic
1184806956 22:46801648-46801670 GCTGCGAGGCAGGCCCTAGACGG - Intronic
1185018722 22:48360678-48360700 ACTACTAAGGAGGCCATGGAGGG + Intergenic
950017681 3:9765801-9765823 ATTGCCAAGGAGGCCCTGGAGGG - Exonic
950670798 3:14524307-14524329 CCTGCCACCCAGGCCCTGGTGGG + Intronic
953748818 3:45594548-45594570 TCCGCTGAGCAGGCCCGGGACGG + Intronic
954139459 3:48597345-48597367 CCTGATAAAGAGGCCCTGGTTGG - Intergenic
954285744 3:49617706-49617728 CCTCCTGAGGAGGCCTTGGACGG + Intronic
956378940 3:68645344-68645366 CATGCCAAGCAGGCCATGTAAGG + Intergenic
957602490 3:82356127-82356149 CCAAGTAAGCAGGCCTTGGAGGG - Intergenic
961935256 3:130576011-130576033 CCATCTAAGAAGCCCCTGGAGGG - Intronic
966867947 3:184271095-184271117 CCAGCTCAGCAGGAGCTGGATGG - Intronic
971884333 4:32423851-32423873 ACTGCAATGCAGGCCCTGGAGGG + Intergenic
972323546 4:37994091-37994113 CCTGCTCAGGAGGTCCTGGAAGG + Intronic
974013434 4:56627532-56627554 CCAGCTAAGGAGGCTCTGCAGGG + Intergenic
981825872 4:148940698-148940720 CAGGCTAAGTAGGCCTTGGAAGG - Intergenic
985622598 5:963279-963301 CCTGCTAGGCATGGCCTGGCTGG + Intergenic
990372961 5:55139403-55139425 CCTGTTCAGCAGGCTCTGAAAGG + Intronic
991456043 5:66805768-66805790 CCTGCGAAGCTGGACCTGGGTGG + Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
998092077 5:139377286-139377308 CATGCAATGCAGGCCCTGCAGGG - Intronic
999674307 5:153983525-153983547 CCTGCTAAGAAGTCACAGGAAGG - Intergenic
999729524 5:154466166-154466188 GCACCTAAGCAGGCCCTTGAAGG + Intergenic
999776613 5:154817070-154817092 GCTGCTTAGAAGGCCCTGGAAGG + Exonic
1001238670 5:170051252-170051274 ACTGCTAAGCAAGGCCTGCAAGG + Intronic
1006829289 6:36959036-36959058 CCTGCTAAGGAGGTGCCGGAAGG + Intronic
1009327868 6:62376148-62376170 CTTGAAAAGCAGTCCCTGGATGG + Intergenic
1010915558 6:81613708-81613730 CCTGCTGAACAGTCACTGGATGG + Intronic
1012243155 6:96897402-96897424 CCCGCTAACCAGGCCCTCGCCGG - Intronic
1015407328 6:132852627-132852649 CTTGATATGCAGGCCCTGGATGG + Intergenic
1016480754 6:144478705-144478727 GCAGCCAAGCAGGCCCTGGCAGG + Intronic
1021995913 7:26178363-26178385 CCTGCTAGCAAGGTCCTGGAAGG - Intronic
1022355556 7:29611241-29611263 GCTGCCAACCAGGCCCTGGGAGG + Intergenic
1023572026 7:41582178-41582200 CCTGCTGCTCAGGCCCTGGGTGG - Intergenic
1024318931 7:48046097-48046119 CCTGGGACGCAGGGCCTGGAGGG + Intronic
1026874378 7:73871097-73871119 ACTGCTAAGCAAGCGCTGGATGG - Intergenic
1034292712 7:149945586-149945608 CCTTCTCAGCAGCCCCTGGCTGG - Intergenic
1034412149 7:150947327-150947349 CCTGTTGAGCTGGCGCTGGAGGG + Exonic
1041894196 8:62904999-62905021 TCTTCTAAGTAGGTCCTGGAAGG - Intronic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1043739490 8:83792436-83792458 GCAGCTTAGCAGCCCCTGGAGGG - Intergenic
1044803560 8:95981566-95981588 CCTCCTAAGAACCCCCTGGAGGG + Intergenic
1044821302 8:96157827-96157849 GATGCTAAGCAAGCCCCGGAAGG + Intronic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1046440978 8:114254646-114254668 CCTGCTCAGAAAGACCTGGAAGG + Intergenic
1048280217 8:133100231-133100253 TCTGATAAGCAGACCCTGAAGGG - Intronic
1049326980 8:142026832-142026854 CCTGCTCAGCAGGCATTGAAGGG - Intergenic
1049418526 8:142506383-142506405 CCTGCTCAGCTGGTCCTGGGTGG + Intronic
1049880428 8:145058327-145058349 CCTGCTAAGCAGGTCTTTCATGG - Intergenic
1049920888 9:363108-363130 CCATCTGAGGAGGCCCTGGAGGG + Intronic
1056214847 9:84397457-84397479 CCTGCTAAGCAGCTCTTAGATGG - Intergenic
1058503297 9:105644782-105644804 TCTGCTAAGCAGGATCTGGCTGG - Intergenic
1061068726 9:128295548-128295570 CCTGGGAAGCAAGCCCTGGGAGG + Intergenic
1061166653 9:128926718-128926740 CCAGCTAACCATGCCCTGGCTGG + Intronic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1061590461 9:131594486-131594508 CCTGCCAAGCAGGGCTTGGCAGG - Intronic
1061865398 9:133489482-133489504 GCTGCCCAGCAGCCCCTGGAAGG - Intergenic
1061866339 9:133493509-133493531 CTTGCTATGCAGGCCATGGCTGG + Intergenic
1061947934 9:133919298-133919320 CCTGCTAAGCTGGCACTTGTGGG + Intronic
1186392669 X:9176233-9176255 GCTGCCAAGTAGCCCCTGGAGGG + Intergenic
1187235921 X:17467036-17467058 AGAGCTTAGCAGGCCCTGGAAGG + Intronic
1187854384 X:23622888-23622910 CCTGCTATGAAGGCCCATGAAGG + Intergenic
1188682725 X:33031328-33031350 ATTGCTAAGCATGCCCTGTAGGG + Intronic
1190041795 X:47078199-47078221 CCTGCAAAGCCGCCCCTGGCAGG - Intergenic
1190822302 X:53985173-53985195 CATGCACAGCATGCCCTGGATGG + Exonic
1194502779 X:94701005-94701027 CGTGCTAACCAGGCCTAGGAAGG + Intergenic
1202014911 Y:20393242-20393264 TGTGCAAAGCAGGACCTGGAAGG - Intergenic