ID: 926135128

View in Genome Browser
Species Human (GRCh38)
Location 2:10331058-10331080
Sequence GCAGATGGGAGGCCACGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926135128_926135133 -8 Left 926135128 2:10331058-10331080 CCATCTCGTGGCCTCCCATCTGC 0: 1
1: 0
2: 0
3: 22
4: 287
Right 926135133 2:10331073-10331095 CCATCTGCTCTCCCGGCTGCAGG 0: 1
1: 0
2: 1
3: 29
4: 241
926135128_926135134 -3 Left 926135128 2:10331058-10331080 CCATCTCGTGGCCTCCCATCTGC 0: 1
1: 0
2: 0
3: 22
4: 287
Right 926135134 2:10331078-10331100 TGCTCTCCCGGCTGCAGGAGCGG 0: 1
1: 0
2: 3
3: 28
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926135128 Original CRISPR GCAGATGGGAGGCCACGAGA TGG (reversed) Intronic
900007482 1:72316-72338 GGAGGTGGGAGGCAAGGAGAGGG - Intergenic
900147245 1:1163585-1163607 GCAGAGGGCAGGCTCCGAGAGGG + Intergenic
901374207 1:8825956-8825978 ACAGAAGTGAGGCCACGGGAAGG + Intergenic
902157901 1:14504502-14504524 GCAGAAAGGAAGCCAGGAGAAGG + Intergenic
902178019 1:14665897-14665919 GCAGTTTGGAGGCTACAAGAAGG + Intronic
902560879 1:17276830-17276852 GCAGAAGTGTGGCCACGGGAGGG + Exonic
902776080 1:18675914-18675936 GCAGATGGGAGGCTAAGTGAGGG - Intronic
903179898 1:21599853-21599875 GGAAATGGGAGGCCAGGAGAGGG - Intronic
903551852 1:24162640-24162662 GCAGGTGGAAGGGCAAGAGAGGG + Intronic
904337185 1:29805501-29805523 GCACTTGGGAAGCCACAAGAAGG + Intergenic
904772542 1:32888380-32888402 GCACATGTGAGGCAATGAGAAGG + Intronic
904939837 1:34157851-34157873 GCAGATGAGAGGGAAGGAGATGG - Intronic
905027811 1:34863232-34863254 GCAGGTGAGAGGGCAAGAGAGGG - Intergenic
905423617 1:37865522-37865544 GCACATGGGAGGCAAGGAGAGGG + Intronic
906636824 1:47415862-47415884 GGGGATGGAAGGCCAGGAGAAGG + Intergenic
908684936 1:66705870-66705892 GGAGTTGGGAGGCAAGGAGAGGG + Intronic
910162870 1:84292668-84292690 GCAGTTGGGAGTGCAGGAGAGGG - Intergenic
911571472 1:99522538-99522560 GCAGATGAGAGGATAAGAGAAGG + Intergenic
915073797 1:153293061-153293083 GCAGAGGGGAAGCCGCCAGAGGG + Intergenic
915874414 1:159597267-159597289 GGGGATGGGAGGGCAGGAGAAGG + Intergenic
917980602 1:180266665-180266687 GCAGGTGGGACGCCATGAGAAGG - Intronic
918122419 1:181551220-181551242 GCAGGTGGGAGGACCAGAGAGGG - Intronic
920051751 1:203168555-203168577 GCAGAGAGGAGGCCAGGAGCAGG - Intronic
920299276 1:204978503-204978525 GGAGATGGGAACCCAGGAGAGGG - Intronic
920329227 1:205193489-205193511 GCAGACAGGAGGCTAGGAGAAGG - Intronic
921643863 1:217589337-217589359 GCAGAGGGGAGGGCATGAGCAGG - Intronic
921654795 1:217721968-217721990 GCAGAAGAGAGGGCAGGAGAAGG - Intronic
923555519 1:234997740-234997762 GAAGATGGGAGTCCAGGAGATGG - Intergenic
1063388916 10:5635871-5635893 GCAGGTGGGAGGCGTCGTGAGGG - Intergenic
1065864954 10:29906470-29906492 ACAGATGGGAGGGCAAGAGAAGG + Intergenic
1065877301 10:30008414-30008436 GCAGATGGAAGCTCACTAGACGG - Intergenic
1065916962 10:30360596-30360618 GAAGATGGGAGCCCCCCAGAGGG + Intronic
1066311050 10:34197035-34197057 GCAGATGGGAAGGCACAGGATGG - Intronic
1067099693 10:43325610-43325632 ACAGTTGGAAGGCCACGTGATGG - Intergenic
1068732250 10:60372500-60372522 GCATATGGGTGGCCATGACAGGG + Intronic
1069849502 10:71396273-71396295 GCAGATGGGAGCGCACGAGTCGG + Intergenic
1070647008 10:78208788-78208810 GGGGAAGGGAGGCCACAAGAAGG - Intergenic
1070781361 10:79139283-79139305 GCAGAGAGGAGGCCACGGCAAGG + Intronic
1070844353 10:79509714-79509736 GCAGAGGACAGGCCAGGAGAGGG + Intergenic
1070929444 10:80250594-80250616 GCAGAGGACAGGCCAGGAGAGGG - Intergenic
1071422233 10:85512091-85512113 GCAGATGGGAGGTGCCGAGATGG + Intergenic
1072199437 10:93145107-93145129 GGAGATGGGTGGTCAGGAGAGGG + Intergenic
1072454986 10:95567661-95567683 GCAGAGGGGAGGGGACAAGAAGG + Intergenic
1073133525 10:101206252-101206274 GCAGATGTGAGGAAAAGAGAAGG + Intergenic
1075317523 10:121464861-121464883 GCAATTGGGAGGCCAAGAGGAGG + Intergenic
1077139093 11:1015719-1015741 ACAGAGGTGAGGCCAGGAGAAGG + Intronic
1077571424 11:3341479-3341501 GCAGAGGCCAGGCCAGGAGAGGG + Intronic
1079259044 11:18860160-18860182 CCAGATGGTAGGCCACAGGATGG + Intergenic
1080005870 11:27405768-27405790 GCAGATGGGAGGCAGGGATAGGG - Intronic
1080035125 11:27701628-27701650 GTGGGTGGGAGTCCACGAGAGGG + Intronic
1082702102 11:56444536-56444558 GCAGTGGGGAGGCCAAAAGAGGG + Intergenic
1082704268 11:56474223-56474245 GCAGTGGGGAGGCCAGAAGAGGG - Intergenic
1083187763 11:61027338-61027360 CCAGAGGGGAGGCCATGGGAAGG - Intergenic
1083581918 11:63830487-63830509 GCAGCTGGGAGGGCAGGAGGTGG - Intergenic
1083791507 11:64989155-64989177 GCAGAGGAAAGGCCAGGAGAGGG + Exonic
1084344888 11:68540146-68540168 TGAGATGGGAAGCCACCAGAGGG + Intronic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1084947228 11:72644659-72644681 GGAGTTGGGAGCCCAAGAGATGG - Intronic
1085013534 11:73157740-73157762 GAAGCTGGGAGGCCAGCAGAGGG + Intergenic
1088446713 11:109938209-109938231 GACAATGGGAGGCCACTAGAGGG - Intergenic
1089292977 11:117449682-117449704 GCAGAGGGGAGCACACTAGAGGG - Intronic
1089874125 11:121703676-121703698 GCAGAGGGGAGGAGAGGAGAGGG + Intergenic
1090237736 11:125161716-125161738 ACAGAGGAGAGGCCACGCGAGGG + Intergenic
1092230371 12:6772705-6772727 GAAGAAGGGAGACCAGGAGAGGG - Exonic
1092602610 12:10083003-10083025 ACAGATGGGAGACCAGAAGATGG + Intronic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1094133760 12:27102415-27102437 GGAGATGGAAGGCCACTGGAGGG - Intergenic
1094183856 12:27620216-27620238 GGAGATGGAAGGCCACTGGAGGG - Intronic
1098908413 12:76185189-76185211 GCAGAGGGGAGGGGAGGAGAGGG - Intergenic
1099121877 12:78700645-78700667 GGAGAGGAGAGGCGACGAGAGGG + Intergenic
1100289481 12:93200280-93200302 GGAGAAGGAAGGCCAGGAGAAGG - Intergenic
1101073897 12:101107997-101108019 TCAGAAGGGAGGAAACGAGAAGG + Intronic
1103601395 12:122056933-122056955 GCAGAGGAGAGGCCTCGAGTAGG - Intronic
1104463066 12:128970531-128970553 GCAAAGGGGAAGCCACCAGAGGG - Intronic
1104621917 12:130320398-130320420 GCAAATGGGAGGGCCAGAGAGGG + Intergenic
1106144847 13:27041273-27041295 GCCGATGGGAGGTCAAGAGCAGG - Intergenic
1107307583 13:39038615-39038637 CCAGACGGGAAGCCAGGAGAGGG - Exonic
1108454347 13:50598059-50598081 GCAGATGGAAGGCGGAGAGAGGG - Intronic
1110741230 13:78999888-78999910 GAAGATGAGAGTCCATGAGACGG - Intergenic
1112978230 13:105347621-105347643 GGGGATGGGAGGCAACGGGAGGG + Intergenic
1114272073 14:21107032-21107054 GCAGCCAAGAGGCCACGAGATGG - Intergenic
1114557405 14:23569941-23569963 GCTGATGGGAGGGGACTAGAGGG - Intronic
1118736032 14:68702594-68702616 GCAGAAGGAAGGCCAGGGGAGGG + Intronic
1120950961 14:90041550-90041572 GCAGATGGTAGGTCACAGGAAGG - Intronic
1121405278 14:93715917-93715939 GCAGATGGGAGGGCCCAAGTAGG + Intergenic
1122244129 14:100389616-100389638 CCAGAGGGGAGGCCAGGTGAAGG - Intronic
1122416745 14:101553455-101553477 GGAGAGGGGAGGCCAAGAGGAGG - Intergenic
1124593250 15:31071561-31071583 GAAGATGGAAGGCCATCAGAAGG - Intronic
1125578296 15:40769408-40769430 GCTGATGGCAGGCCAAGAGGAGG + Intronic
1125715402 15:41817141-41817163 GCAGCTGGGAGGCCTGGAGCTGG + Intronic
1125859619 15:42986794-42986816 ACAGGTGGGAGGCCACGCCACGG + Intronic
1128473346 15:67975158-67975180 GCAGTTGGGAGGGCAGGAGGGGG - Intergenic
1128661095 15:69501633-69501655 GCCGAAGGGAGGGCAGGAGAAGG - Intergenic
1129661812 15:77556962-77556984 CAAGATGGGAGCCCAGGAGAGGG + Intergenic
1129785144 15:78304790-78304812 GCAGACAGGAGGCCTGGAGAGGG - Intergenic
1130230192 15:82091145-82091167 GGAGGTGGGAGGAAACGAGACGG - Intergenic
1132063811 15:98714058-98714080 GCAGATTGGAGCCTTCGAGAAGG + Intronic
1132374711 15:101321336-101321358 GCAGCTAGGAGTCCAGGAGAGGG - Intronic
1132606325 16:795281-795303 GCACATGGAAGGCCACGGGCAGG - Exonic
1132933402 16:2469793-2469815 GCAGATGTGTGGCAAGGAGAAGG + Intergenic
1134633752 16:15776834-15776856 GCAGAGGGGAGGGCAGGTGAGGG + Intronic
1136123250 16:28155808-28155830 GTAGAAGGGAGGACAGGAGATGG + Intronic
1136628198 16:31474360-31474382 GCCTTTGGGAGGCCAGGAGACGG - Exonic
1137478495 16:48831264-48831286 TGAGATGGGAGGTCACCAGAAGG + Intergenic
1137837361 16:51605691-51605713 GCATATAGAAGGCCATGAGAAGG - Intergenic
1139138556 16:64233823-64233845 GCAGAGGGGAGACCCAGAGAGGG - Intergenic
1140691816 16:77491932-77491954 GCAGAAGTGAGGCCACCAGGAGG + Intergenic
1141072617 16:80972008-80972030 TCACATGGGAGGACAGGAGATGG - Exonic
1141222290 16:82082236-82082258 GCAGATAGAAGGTCAGGAGAAGG - Intronic
1142272657 16:89098668-89098690 GCAGGTGGAAGGGCACGATAAGG - Exonic
1143754921 17:9059855-9059877 GCAGATGGGAAGACTCAAGAGGG + Intronic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1145918702 17:28593501-28593523 GCATTTGGGAGGCCACAAGCAGG + Intronic
1147392429 17:40118490-40118512 TGAGATGGGAAGCCATGAGAGGG + Intergenic
1147670943 17:42176427-42176449 GGAGATAGAAGGCCAGGAGAGGG + Intronic
1148875982 17:50687488-50687510 GCAGGTGGGAGGCCCCCAGCTGG + Intronic
1148994831 17:51700561-51700583 GCAGATGGAAGGCCATGAGGGGG - Intronic
1151182209 17:72337475-72337497 GAAGATGGGATGACAGGAGAGGG - Intergenic
1151182233 17:72337566-72337588 GAAGATGGGATGACAGGAGAGGG - Intergenic
1155232951 18:23792613-23792635 GCATATGGGAAGCCTCGGGAGGG + Intronic
1157191379 18:45585075-45585097 GGAGATGGGAAGCCACTGGAAGG - Intronic
1157280992 18:46346196-46346218 TGAGAGGGGAGGCCAGGAGACGG + Intronic
1157479943 18:48047263-48047285 GAAGATGGGAGGCAAAGGGATGG - Intronic
1157772147 18:50358618-50358640 GAAGATGGGAGGAAACAAGACGG - Intergenic
1158075221 18:53520247-53520269 GCAGATGAGAGGCCGCAATATGG + Intronic
1158229825 18:55241994-55242016 GCAGATGAGAGGCCATGCGTAGG - Intronic
1158325422 18:56308596-56308618 GTAGATGGGGGGTCAGGAGAAGG + Intergenic
1160628289 18:80228302-80228324 GCGGAGGGGAGGCCAGGGGAGGG + Intronic
1160639238 19:113911-113933 GGAGGTGGGAGGCAAGGAGAGGG - Intergenic
1160889640 19:1370552-1370574 GCCGATGGGAGGCTGCGACATGG - Intronic
1161045237 19:2130993-2131015 GCAGTGGGGAGCCCACGAGAGGG - Intronic
1161354433 19:3811016-3811038 GCTGTTGAGTGGCCACGAGACGG + Intronic
1161355079 19:3814530-3814552 GCAGCAGGGAGGCCCTGAGAAGG - Intronic
1161875619 19:6906757-6906779 GCAGATGTGAGGGCAGGAGCTGG - Intronic
1166060706 19:40323713-40323735 TCAGATGGGGGCCCAGGAGAGGG + Intronic
1168650134 19:58087297-58087319 GCAGGTGGGTGGGCACGAGCAGG - Exonic
926135128 2:10331058-10331080 GCAGATGGGAGGCCACGAGATGG - Intronic
926746520 2:16163003-16163025 GGAGGTGGGAGGGCAGGAGATGG - Intergenic
928085169 2:28341654-28341676 GCATCTGTGAGGCCCCGAGAAGG + Intergenic
928308918 2:30193822-30193844 GCAGCTGGCAGGCCATGGGAAGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931068996 2:58622936-58622958 GCAGAGGGGAGACTAAGAGAGGG - Intergenic
931265501 2:60656559-60656581 GCAGATAGGAGGACATCAGAGGG + Intergenic
931933045 2:67162358-67162380 GCAGATGGAGGGCCAGGGGAGGG + Intergenic
933275867 2:80283822-80283844 GAAGATGGGAGGGCAAAAGAAGG + Intronic
933427820 2:82135510-82135532 GGACATGGGAGGTCACAAGATGG - Intergenic
933624669 2:84585596-84585618 GCAGAGAGGAGGCCTGGAGAGGG + Intronic
935646511 2:105340267-105340289 TCAGATGAGAAGCCACTAGAAGG + Intronic
936412067 2:112268801-112268823 GAAGATGGGAGGGCAAGAAAGGG + Intergenic
936559750 2:113526969-113526991 CCAGATGGCAGGCGACAAGAGGG - Intergenic
937302259 2:120850462-120850484 GCAGATGGGAGGGGACAATAAGG + Intronic
938373074 2:130786030-130786052 ACAGAAGAAAGGCCACGAGAAGG - Intergenic
938389322 2:130892774-130892796 GGAGCTGGGAGTCCAGGAGAGGG - Intronic
939476008 2:142687143-142687165 GCAGAGGGGAGGGGAGGAGAGGG + Intergenic
942284013 2:174395802-174395824 GTAGCTGGGAGGCCAGGTGAGGG + Exonic
943107698 2:183567071-183567093 TAAGATGGGAGGCCAGGTGAGGG + Intergenic
944505638 2:200408003-200408025 CCAGATGGTAGGCAACGTGAGGG - Intronic
944649910 2:201819487-201819509 GGAGATGAGAGGCCACTGGAGGG + Intronic
946083070 2:217142847-217142869 GCAGGCTGGAGGCCACCAGAGGG - Intergenic
946194123 2:218023007-218023029 CCAGACGTGAGGCCACGTGAGGG - Intergenic
948232173 2:236356485-236356507 CCAGCTGGGGGGCCACGCGACGG + Intronic
948232271 2:236358835-236358857 CCAGCTGGGGGGCCACGTGACGG - Intronic
948353916 2:237362037-237362059 GCAGATGGGAGGTCACCAATAGG + Intronic
948935168 2:241159158-241159180 GCAAGGGGGAGGCCACGAGAAGG - Intronic
1168964755 20:1892674-1892696 GCAGTTGGGAGACCCCTAGAGGG - Intergenic
1170442704 20:16395241-16395263 GGAGAGGGGAGGCCAAGGGAGGG + Intronic
1170442721 20:16395276-16395298 GGAGAGGGGAGGCCAAGGGAGGG + Intronic
1170442735 20:16395306-16395328 GGAGAGGGGAGGCCAAGGGAGGG + Intronic
1170442752 20:16395341-16395363 GGAGAGGGGAGGCCAAGGGAGGG + Intronic
1172707631 20:36894039-36894061 GCAGGTGGGAGTCCAGGAGCTGG - Exonic
1172777602 20:37416508-37416530 GCAGCAGGAAGGCCACCAGAGGG - Intergenic
1173304314 20:41833616-41833638 GCAGATGGGAGGCAAGGATTGGG + Intergenic
1173363675 20:42366437-42366459 GCCAGTGGGAAGCCACGAGATGG - Intronic
1173659407 20:44723012-44723034 TGAGATGGGAAGCCACCAGAAGG - Intronic
1173667437 20:44772875-44772897 GGAGGAGGGAGGCCAGGAGAAGG - Intronic
1176152537 20:63599385-63599407 GGAGATAGGAGGCCTCCAGATGG - Intronic
1176180332 20:63746814-63746836 GCAGAGGAGGGGCCGCGAGAGGG + Exonic
1179048682 21:37869979-37870001 GCAGAGGGTAGGCCAAGACAAGG + Intronic
1179438711 21:41379060-41379082 GCAGCAGGGAGGCCAGGGGAGGG - Intronic
1179502976 21:41821481-41821503 GCACAGGGGAGGCCTCGTGAGGG + Intronic
1180589141 22:16921391-16921413 GCAGCTGGGATGCCACAGGAGGG + Intergenic
1180796128 22:18606658-18606680 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181104315 22:20564706-20564728 GCAGGAGGGAGGCCAAGAGCAGG - Intronic
1181225594 22:21388613-21388635 GCAAATGGGGGGCCAGGGGAAGG + Exonic
1181253040 22:21546200-21546222 GCAAATGGGGGGCCAGGGGAAGG - Exonic
1181488572 22:23247165-23247187 GAAGATGGGAGGCCAAGAGGAGG + Intronic
1181536908 22:23551084-23551106 ACAGATGGGAGGACAGGTGAAGG - Intergenic
1181688809 22:24546833-24546855 GCAGTGGGGAGGCCTCGGGATGG - Intronic
1183075853 22:35426311-35426333 CCTGAAGGGAGGCCAGGAGAGGG + Intergenic
1184391949 22:44207775-44207797 GCAGATGGGAGGCTAGGTGAAGG - Exonic
1184867641 22:47210271-47210293 GAAGAAGGGTGTCCACGAGATGG - Intergenic
1185236146 22:49714448-49714470 GCAGATCGCTGGCCACGGGATGG - Intergenic
950554293 3:13685957-13685979 GCTGCTGGGAGGCCAGGAAATGG + Intergenic
950783143 3:15409647-15409669 GCAGAGGGGAGGACAGGTGATGG + Intronic
951923979 3:27887103-27887125 TGAGATGGGAGGCCATTAGAAGG - Intergenic
952163892 3:30724740-30724762 GCAGAAGGAAAGCCAAGAGAGGG - Intergenic
953336650 3:42099337-42099359 GCAAATGGGAGGAAATGAGAGGG + Intronic
953772149 3:45785946-45785968 GAGGATGAGAGGCCACGAGGAGG + Intronic
956985435 3:74693984-74694006 GCACATGGGAGGCCAAGGGTGGG - Intergenic
957073052 3:75580553-75580575 GGAGAAGGGACGCCCCGAGAGGG + Intergenic
958636297 3:96750875-96750897 GCAGAGAGGAGGCCTGGAGAGGG - Intergenic
960543030 3:118881602-118881624 ACAGAAGGAAGGCCATGAGACGG + Intergenic
961370345 3:126424798-126424820 GCAGATGGGAGGGGTAGAGAAGG + Intronic
961693941 3:128690934-128690956 GGAGATAGGAGGGCAGGAGAAGG + Intergenic
961819739 3:129569897-129569919 GCAGCTGGGGGGCAGCGAGACGG - Exonic
962372360 3:134831253-134831275 GCAGCTGGGAGACCAGGAGTGGG + Intronic
965509021 3:169547799-169547821 CCAGAGGGAAGGCCATGAGAAGG + Intronic
965996352 3:174887080-174887102 GCAGATGGCAGGCAAGAAGATGG - Intronic
966305643 3:178531049-178531071 GGAGATGGGAGGTCAGGGGAGGG - Intronic
967744586 3:193041007-193041029 GCAAATGGGAGGCTCAGAGAAGG + Intergenic
968136662 3:196224708-196224730 GGAGATGGGAGGGGAGGAGAGGG + Intronic
969181582 4:5446120-5446142 GCAGATGGGATGCCCTGAGGGGG - Intronic
969548758 4:7850049-7850071 TGGGATGGGATGCCACGAGAAGG + Intronic
970384271 4:15540833-15540855 GCAGAGCGGAGGTCTCGAGAAGG + Exonic
971803399 4:31321840-31321862 GTACGTGTGAGGCCACGAGAAGG - Intergenic
972331014 4:38064568-38064590 GCAGCTGGGAGGCAGCCAGAGGG + Intronic
972783401 4:42305647-42305669 GCAGAATGGAGCCCACGACATGG - Intergenic
973309801 4:48696527-48696549 GCAGGTGGGGGGCAAGGAGAGGG + Intronic
974999253 4:69199494-69199516 TCAGATGGGAGGCCGGGAGGGGG + Intronic
978699231 4:111622885-111622907 GCAGGTGGGGGGCTAGGAGAAGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
981114756 4:140976670-140976692 AGAGAAGGGAGGCCAGGAGAGGG - Intronic
983625324 4:169796401-169796423 GGAGATGAGAGGCCTCTAGAGGG - Intergenic
984819291 4:183866181-183866203 GCAGAGGGGTGGCCACTTGAAGG - Intronic
986613395 5:9592142-9592164 GCAGGTGGGAGGCAAGGGGAGGG + Intergenic
988342195 5:29986972-29986994 GCACATGGGAGCACACGAAATGG - Intergenic
990306137 5:54495631-54495653 GCAGTTGGGAGGTCAAGAAAAGG - Intergenic
991359575 5:65805177-65805199 TCAGATAGGAGGCCAAAAGAGGG - Intronic
991917356 5:71618346-71618368 GAAGGTGGGAGGGCAAGAGAGGG - Intronic
991998265 5:72409949-72409971 GGAGATGGGAGGAAAGGAGAAGG - Intergenic
992282439 5:75195164-75195186 GCAGTTGGGATGCCAGGGGAGGG - Intronic
998268272 5:140683174-140683196 GCAGATGGCAGTTCGCGAGAAGG - Exonic
998470841 5:142382606-142382628 GCAACTGTGAGGCCCCGAGATGG + Intergenic
999201916 5:149822678-149822700 AGAGATGGGAGCCCATGAGAGGG - Intronic
1000014921 5:157267525-157267547 GGAGGTGGGAGGCCACCAGGAGG - Intronic
1001191201 5:169633157-169633179 TCTGATGGGAGGCCAAGAGTAGG - Intergenic
1002069779 5:176672297-176672319 GCAGTGGGGAGGCGAGGAGATGG + Intergenic
1002746589 6:62317-62339 GGAGGTGGGAGGCAAGGAGAGGG - Intergenic
1004111894 6:12726819-12726841 GCAGGTGGGAGGACATTAGAAGG - Intronic
1007335312 6:41151245-41151267 GGATTTGGGAGGCCAGGAGAAGG - Intronic
1007636240 6:43301483-43301505 GCAGATGGGAGGAATAGAGAGGG + Intronic
1010769313 6:79810619-79810641 GATGGCGGGAGGCCACGAGAGGG - Intergenic
1014265243 6:119269500-119269522 GCAGATGGGGGGCCTCAGGAAGG + Intronic
1016339643 6:143049343-143049365 GCAGAGAGGAGGCCCTGAGAGGG + Intergenic
1016387646 6:143544031-143544053 GAAGATAGGAGGTCAAGAGAAGG - Intronic
1018533671 6:164795601-164795623 GCAGCTGAGAGGCCATGAGGAGG + Intergenic
1018724825 6:166603745-166603767 GCAGAAGGGAGGCCAGGGAATGG + Intronic
1019351728 7:557152-557174 GGAGATGGGAGGGCAGGAGGAGG - Intronic
1019491198 7:1314389-1314411 GCAGGTCGGAGGCCACGGGGAGG - Intergenic
1021258824 7:18428731-18428753 GCAGATGGGAAGCTACTGGAGGG - Intronic
1024062027 7:45704963-45704985 GCTGATGGGAGGAGAAGAGAGGG - Intronic
1024444943 7:49466157-49466179 GCAGAGGGAAGGACAGGAGAAGG + Intergenic
1024583746 7:50823302-50823324 ACAGATGGGAAGCCACCAGAGGG - Intergenic
1026760969 7:73125363-73125385 GCAGATTGGAAGCCACCAGAAGG - Intergenic
1027037310 7:74934159-74934181 GCAGATTGGAAGCCACCAGAAGG - Intergenic
1027086252 7:75267296-75267318 GCAGATTGGAAGCCACCAGAAGG + Intergenic
1028242585 7:88439200-88439222 GGAGGTGGGAGGCTAGGAGAGGG - Intergenic
1028686680 7:93597606-93597628 GCAGAAGTGAGGCCAAGAGATGG + Intronic
1029201895 7:98844743-98844765 GGATTTGGGAGGCCACCAGAAGG + Intergenic
1029392556 7:100285320-100285342 GCAGATTGGAAGCCACCAGAAGG + Intergenic
1029450675 7:100640561-100640583 GCAGATGGGAGGACTCAGGAGGG + Intronic
1030548706 7:110931721-110931743 TAAGATAGGAAGCCACGAGAGGG - Intronic
1031827197 7:126580516-126580538 GGATATGGGAGACCAGGAGATGG - Intronic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1032783985 7:135186297-135186319 GCAGCTGGGTGGCGATGAGAAGG - Exonic
1035476638 7:159148808-159148830 GCAGAGTGGAGGCTGCGAGACGG - Intergenic
1036258391 8:7222284-7222306 AGAGAAGGGACGCCACGAGAGGG + Intergenic
1036259451 8:7228428-7228450 AGAGAAGGGACGCCACGAGAGGG + Intergenic
1036307173 8:7611096-7611118 AGAGAAGGGACGCCACGAGAGGG - Intergenic
1036311493 8:7686998-7687020 AGAGAAGGGACGCCACGAGAGGG + Intergenic
1036358017 8:8059083-8059105 AGAGAAGGGACGCCACGAGAGGG - Intergenic
1036688125 8:10925075-10925097 GCAAATGGGAGACCAGGAGGAGG - Intronic
1036892932 8:12607863-12607885 AGAGAAGGGACGCCACGAGAGGG + Intergenic
1037097995 8:15008657-15008679 GGAGATGGGAGGGGAGGAGATGG + Intronic
1037361724 8:18081424-18081446 GCCAATGGGAGGCCATTAGATGG - Intronic
1037391593 8:18398506-18398528 AGAGATAGGAGGCCAGGAGAAGG + Intronic
1037458330 8:19084721-19084743 GCAGAAGGCAGGCCCTGAGACGG - Intronic
1038488995 8:27956052-27956074 CAAGTGGGGAGGCCACGAGAAGG + Intronic
1039898873 8:41736171-41736193 CCAGATGGGAATCCAGGAGAAGG + Intronic
1042228305 8:66532455-66532477 GCATTTGGGAGGCCAAGAGGGGG - Intergenic
1042710824 8:71715340-71715362 GCAGAAGGGAGGCCAGGAATTGG + Intergenic
1043982297 8:86657069-86657091 GAAGATGGGAGCCCCCGTGAAGG + Intronic
1046048489 8:108990854-108990876 GGGGATGGGAGGCAAGGAGAGGG + Intergenic
1046736714 8:117783925-117783947 GAAGATGGGAGGGGAGGAGAGGG - Intergenic
1047612890 8:126538388-126538410 ACAGAGGGAAGGCCACGTGAAGG + Intergenic
1049435459 8:142584239-142584261 GAGGCTGGGAGGCCAGGAGAAGG + Intergenic
1049807329 8:144546934-144546956 TCAGCTGGGAGTCCACGAGGAGG - Intronic
1049893117 9:89403-89425 CCAGATGGCAGGCGACAAGAGGG + Intergenic
1053132059 9:35621257-35621279 GTAGTGGGGAGGCCAGGAGAGGG - Intronic
1053734331 9:41089456-41089478 CCAGATGGCAGGCGACAAGAGGG + Intergenic
1054694059 9:68342116-68342138 CCAGATGGCAGGCGACAAGAGGG - Intronic
1054993195 9:71353990-71354012 TGAGATGAGAGGCCATGAGATGG - Intronic
1056108786 9:83373808-83373830 GCAGGTGGGATGCCTCCAGAAGG - Intronic
1056831431 9:89920301-89920323 GCAGCTGGGAGGCCAGGTGGAGG + Intergenic
1056900473 9:90594767-90594789 GCAGAGGAGAGGCCAGGAGAAGG + Intergenic
1058812685 9:108656566-108656588 GAAGAGAGGTGGCCACGAGATGG + Intergenic
1059313075 9:113401496-113401518 GCAGGAGGGAGGCCACGAGGGGG + Intergenic
1061189848 9:129076034-129076056 CCATATCGGAGGCCAAGAGAGGG + Intergenic
1061666334 9:132162727-132162749 AGAGATGGGAGGGCACGGGATGG - Intronic
1061963927 9:134002875-134002897 GCACTGGGGAGGCCAGGAGATGG - Intergenic
1062501399 9:136853517-136853539 GCAGGTGAGAGGTCAGGAGACGG - Intronic
1188143996 X:26587078-26587100 GCAGAGGGGAGACCCAGAGAAGG - Intergenic
1190158505 X:48012990-48013012 GCAGATGGGAAGTCATGAGAAGG - Intronic
1190174200 X:48135256-48135278 GCAGATGGGAAGTGATGAGAAGG - Intergenic
1192885019 X:75327854-75327876 GCAGGTGGGAGCCCCCGAGGAGG - Intergenic
1196547618 X:116981461-116981483 GCGGATGGGGGGCTAGGAGAGGG + Intergenic
1197772434 X:130097930-130097952 GCAGAGGGCAGGCGACCAGATGG - Intronic
1198915653 X:141668606-141668628 ACAGATGGCAGGGCAGGAGAGGG - Intronic
1200367250 X:155679876-155679898 GCAGACGGTAGGCGAAGAGAGGG + Intergenic