ID: 926137290

View in Genome Browser
Species Human (GRCh38)
Location 2:10345875-10345897
Sequence GTCCTTGCCCCTTTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926137290_926137293 0 Left 926137290 2:10345875-10345897 CCCACCACAAAAGGGGCAAGGAC 0: 1
1: 0
2: 1
3: 13
4: 199
Right 926137293 2:10345898-10345920 TGCGAACTTTTGCCGTATTTTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926137290 Original CRISPR GTCCTTGCCCCTTTTGTGGT GGG (reversed) Intronic
903421184 1:23218494-23218516 GTCCTTACCGGTTTTTTGGTTGG + Intergenic
905465896 1:38152935-38152957 CTTCTTGGCCCTCTTGTGGTTGG + Intergenic
907592822 1:55691866-55691888 GTCCTTATCCCTTTTTTGGAAGG + Intergenic
908611145 1:65862675-65862697 GTCCTGGACCTTTTTTTGGTTGG + Intronic
909160136 1:72136672-72136694 GTCTTTGCCCATCTTGTGCTTGG - Intronic
912300939 1:108516407-108516429 GTCCTGGCCTTTTTTTTGGTTGG + Intergenic
912483932 1:110008882-110008904 GGCCTTCCCCCATTTCTGGTGGG + Intronic
913930997 1:124964465-124964487 GTCCTGGACTCTTTTTTGGTTGG + Intergenic
915921817 1:159981474-159981496 GCCCTTGCTCCTTTCTTGGTTGG - Intergenic
916052270 1:161044855-161044877 AATCTTGCCCCTTTTGTGTTGGG - Intronic
917434436 1:175005275-175005297 GTCCTTGCTCATGTTGTGGTTGG + Intronic
917715418 1:177732186-177732208 GTCCTTGCCCATTTTTAAGTTGG - Intergenic
917764330 1:178200652-178200674 GTCCATGCACCTTTTGTTGCAGG - Intronic
918171472 1:182002235-182002257 TTCCTTGCCCCTTTTGCTATTGG + Intergenic
919111810 1:193229462-193229484 TTCCTTGCTCCTTCTGTGATAGG + Intronic
919445841 1:197704125-197704147 GTCCTAGCCACTTTGGTGGCTGG + Intronic
920927369 1:210355071-210355093 TTCCTTTCTCCTTTTGTGATTGG + Intronic
923684333 1:236143227-236143249 CTCCTTGCCCCTTTTGGGAATGG - Intronic
924365813 1:243292239-243292261 GTCCTTTCCCCCCTTGAGGTGGG + Intronic
1063513542 10:6671184-6671206 CTTCTTGCCCCTTTTGGGGTTGG + Intergenic
1066145240 10:32551024-32551046 GTCCTGGCCCTTTTTTTTGTTGG + Intronic
1066816905 10:39430164-39430186 GTCCTTTGCCCATTTTTGGTTGG - Intergenic
1067012878 10:42730927-42730949 TTCCTTGCCCCCTTTGTAGCTGG + Intergenic
1069597360 10:69681121-69681143 GTCCTTGCCCCTTTTCCACTGGG - Intergenic
1070160787 10:73865672-73865694 GGCCTCGCCCTTTTTGGGGTTGG - Intronic
1070605575 10:77895947-77895969 CTCCTTTCCCCTTTTGATGTGGG + Intronic
1070636084 10:78128707-78128729 GTTCTGGCCACATTTGTGGTTGG + Intergenic
1071165823 10:82805211-82805233 GTCCTTGCTAATATTGTGGTAGG + Intronic
1076378546 10:130009443-130009465 GACCTTGCCCCCATTGTGGCGGG - Intergenic
1077303618 11:1858207-1858229 GTCCTTGCCCCTGTGGGGTTCGG + Intronic
1079442004 11:20524314-20524336 GTCCTTGCTGCTTCTGGGGTTGG + Intergenic
1079887177 11:26003360-26003382 GTCCATGCCCCTTATGTGAAGGG + Intergenic
1079933707 11:26593672-26593694 GTCCATGCCCCTTATGTGAAGGG - Intronic
1081113311 11:39164674-39164696 ATCATTGCCCCTTCTGTGATAGG - Intergenic
1087753823 11:102034044-102034066 GTCCTGGACCTTTTTTTGGTTGG + Intergenic
1088074434 11:105829463-105829485 GTCCTTGCCACTTTTGTCACTGG - Intronic
1088188124 11:107196443-107196465 GTCAATGCCCCTTTTGAAGTAGG + Intergenic
1088700673 11:112408465-112408487 GTCCTTCCCCATTTTATGGCAGG + Intergenic
1090298414 11:125611409-125611431 CTCCTTCCCTCTTTTGTAGTTGG + Exonic
1093049271 12:14487630-14487652 GTACATGCCTCTTTTGTTGTAGG + Intronic
1096891930 12:54780242-54780264 GTCCTGGACCTTTTTTTGGTTGG - Intergenic
1097438245 12:59577190-59577212 TTCCTTCCCCCATATGTGGTAGG + Intergenic
1098534711 12:71581578-71581600 GTCCTTGCCTTTTTTGTTTTAGG + Intronic
1099108218 12:78522457-78522479 GTCCTGGGCCTTTTTTTGGTTGG - Intergenic
1099139588 12:78955552-78955574 TTGCTTACCCCTTCTGTGGTGGG - Intronic
1099970529 12:89495568-89495590 TTCCTTGACCCTGTTGTGGCAGG - Intronic
1102722936 12:115033786-115033808 CTCCGTGCCCCTTTTTTGGTGGG - Intergenic
1103810018 12:123605806-123605828 CTCAGAGCCCCTTTTGTGGTGGG + Intronic
1104445498 12:128829754-128829776 GTCCTTGCCCCTTTTCTAGAGGG - Intergenic
1111341866 13:86897387-86897409 GTCCTGGCCTTTTTTTTGGTTGG - Intergenic
1113387336 13:109860760-109860782 TTCCTTGCCACCTTTGTGGTGGG - Intergenic
1116588301 14:46738267-46738289 GTCCTGGCCTGTTTTTTGGTTGG + Intergenic
1117672458 14:58122790-58122812 GTCCATGCCCCTTATGTTGAGGG + Intronic
1117864883 14:60136755-60136777 GTTCTGGCCCTTGTTGTGGTGGG + Exonic
1119150042 14:72350468-72350490 GTCCCTGGCTCCTTTGTGGTTGG + Intronic
1127824922 15:62694748-62694770 ATTCTGGCCCCTTTTGTGGGAGG + Intronic
1128748401 15:70131229-70131251 GTCCTTGATCCTTCTGTGATAGG + Intergenic
1129549739 15:76435163-76435185 TTCCTGGCTCCCTTTGTGGTTGG - Intronic
1129666580 15:77582696-77582718 GTCACTGCCCCTTTTATGGGCGG - Intergenic
1129713340 15:77832676-77832698 GGCCTTGCCCCTTCTGAGCTGGG - Intergenic
1130079520 15:80720275-80720297 GGCCTTTCCCCTTTCTTGGTGGG + Intronic
1139486249 16:67258238-67258260 GTCCTTGCCCCGTCTGAGGAAGG + Intronic
1139616836 16:68100833-68100855 GTCTTTGCCCCTTTTTAGATTGG + Intronic
1141685149 16:85565874-85565896 GTCCTTGCCAGTCTTCTGGTGGG + Intergenic
1146836114 17:36112332-36112354 GTGCATGCCCCTTTTGTTGCAGG - Intergenic
1147262471 17:39216765-39216787 GTCCCTGCTCCCATTGTGGTGGG - Intronic
1147878741 17:43640545-43640567 GCTCTTGCCCTTTTTGGGGTGGG + Exonic
1148113728 17:45162407-45162429 TCCTTTGCCCCTTTGGTGGTTGG + Intronic
1150500529 17:65646795-65646817 GCCCTGGCCCCTGTTGTGCTGGG - Intronic
1154489726 18:14910946-14910968 GTCCTTTCCCACTTTTTGGTGGG + Intergenic
1157397030 18:47350854-47350876 GTCCTGGACTCTTTTTTGGTTGG + Intergenic
1157684749 18:49633028-49633050 GTCCCAGCCCCTTGTGCGGTAGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159646510 18:70924470-70924492 GTCCTTGGCTTTTTTTTGGTTGG - Intergenic
1159690291 18:71478755-71478777 ATCCTTGCCCATTTTTTGATGGG - Intergenic
1162741435 19:12775764-12775786 GCCCTGGCCCTTTTTGGGGTGGG + Intronic
1165247184 19:34504526-34504548 CTCCCTGCCCCTGTTGGGGTGGG + Exonic
1165367647 19:35378635-35378657 GTCCTTGACCCTGTTGAGGTGGG + Intergenic
1167731045 19:51255608-51255630 GTCCTTGCCCATTTTTTAATTGG - Intronic
925491419 2:4399516-4399538 GTCCCTGCCACTTTTGTATTCGG + Intergenic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
928547405 2:32341419-32341441 TTTCTTGCCCCTTTTATGGAAGG - Intergenic
929674509 2:43912103-43912125 ATCCATGTACCTTTTGTGGTGGG - Intronic
933927932 2:87117094-87117116 GTTTTTGTTCCTTTTGTGGTTGG + Intergenic
934721933 2:96585299-96585321 TCCCTTGCCCTTTTTGTGATGGG - Intergenic
935310968 2:101782933-101782955 GTCTTTGCCTTTTTTGTGGTTGG + Intronic
939634589 2:144565952-144565974 GTACTTGCCTCAGTTGTGGTGGG + Intergenic
940679144 2:156762210-156762232 GTCCTTGCCCACTTTTTGATGGG - Intergenic
941114707 2:161459121-161459143 GTCCTTGGGCTTTTTTTGGTTGG + Intronic
941567043 2:167122264-167122286 GTTCTTACCCCATTTTTGGTTGG - Intronic
942590006 2:177533423-177533445 GTCCCTGGCCCTTTTGTCTTGGG - Intronic
944147523 2:196522303-196522325 GTCCTTGCCCACTTTTTGATGGG + Intronic
944400506 2:199320458-199320480 GCCCTTGCCCCTTTCTTCGTGGG - Intronic
945383429 2:209168210-209168232 GTCCTTGCCCACTTTTTGATGGG - Intergenic
945390978 2:209264886-209264908 GTCCTGGACCTTTTTTTGGTTGG - Intergenic
945429390 2:209746999-209747021 GTCCTTGCCCACTTTTTGATGGG + Intergenic
947105772 2:226666514-226666536 GTCATTTCACCTTTTGTGATTGG - Intergenic
947681082 2:232034094-232034116 GTCCTGGGCCTTTTTTTGGTTGG + Intronic
947908821 2:233788560-233788582 GTCCTTCCTCCTCTGGTGGTAGG - Intronic
948103128 2:235391212-235391234 TTCCTTGCTCCTTTAGTCGTAGG - Intergenic
1170294557 20:14809953-14809975 GTCCTGGGCCTTTTTTTGGTTGG - Intronic
1171013324 20:21520366-21520388 ATATGTGCCCCTTTTGTGGTGGG - Intergenic
1172644862 20:36462716-36462738 CTCCTTTCCCCCTTTGTGGGAGG - Intronic
1172981984 20:38950334-38950356 ATGCCTGCCCCTATTGTGGTTGG + Intronic
1174445274 20:50586902-50586924 GGCCTTGGCCCTTTTGTAGGTGG + Exonic
1174485196 20:50856580-50856602 CTCCTTGTCCCTTTTGTGTCTGG + Intronic
1175578457 20:60080215-60080237 CTCCTTTCCCTTTTTGTGGTTGG - Intergenic
1177943065 21:27434567-27434589 GTCCTGGACTCTTTTTTGGTTGG + Intergenic
1179064337 21:38010360-38010382 GTCCTTGCACCTCTTGTTGATGG + Intronic
1181483018 22:23212970-23212992 GTCCTTGTCCTTTTTGAGGCCGG - Intronic
1181590446 22:23881482-23881504 GTACTTGCCCCTTTAGTGGGAGG + Intronic
1182429526 22:30291665-30291687 GTCCCTGCCCCCTTGGTGGGTGG + Intronic
1184778465 22:46635034-46635056 GTCCTTCGTCCCTTTGTGGTTGG + Intronic
949239465 3:1852592-1852614 GTCCTAGCCTTTTTTTTGGTTGG + Intergenic
950671110 3:14525900-14525922 GTCCTTGCCTCCTTTGGAGTAGG + Exonic
951522545 3:23622702-23622724 TCCCTTGCCCCTTCTGTGATGGG - Intergenic
952012935 3:28922067-28922089 GTCCTTGTCTTTTATGTGGTAGG + Intergenic
954765790 3:52914956-52914978 CACCTTGCCCCTTGTGAGGTGGG + Intronic
955602355 3:60660113-60660135 TTCTTTTCCCCTTTTGTGTTTGG - Intronic
957256290 3:77842024-77842046 GTCCTTGGCTTTTTTTTGGTTGG + Intergenic
959125483 3:102285434-102285456 GTCTTTGCCCATTTTTTGATGGG + Intronic
960946034 3:122967421-122967443 GTGCCTGCCCCATTTGTGGGTGG + Intronic
961530237 3:127536145-127536167 CTCCTTGCCCTTTTTGTCCTTGG + Intergenic
962562413 3:136620880-136620902 ATGCTTAACCCTTTTGTGGTAGG - Intronic
962666359 3:137657705-137657727 GTCCTTGACTTTTTTTTGGTTGG - Intergenic
967975057 3:195029699-195029721 CTTCTTGCCCCTTGTGTGGCTGG + Intergenic
968504765 4:966695-966717 GTCCCTGCACCTTTTGGGTTTGG - Intronic
968730282 4:2266170-2266192 GTACTTGCCTCTTGGGTGGTTGG + Intergenic
969441881 4:7222058-7222080 GCCCTTTCCCCTTGTCTGGTGGG - Intronic
971170205 4:24226000-24226022 ATCCTTTCCCGTTTTGTGGGTGG - Intergenic
971922964 4:32967964-32967986 TTCTTTGCCCATTTTGTGATGGG - Intergenic
975056015 4:69929775-69929797 GTCCTGGCCTTTTTTTTGGTTGG + Intergenic
975722606 4:77262817-77262839 GTCCCTGACCTTTCTGTGGTAGG - Intronic
977420947 4:96798883-96798905 GTCCTGGACTCTTTTTTGGTTGG - Intergenic
981338062 4:143589064-143589086 GTCCTTGGCCCACTTGTGGATGG + Intronic
982870862 4:160577410-160577432 GTCCTGGACTCTTTTTTGGTTGG - Intergenic
984437893 4:179727244-179727266 GTACTTGCCCTTTTTCTAGTTGG + Intergenic
986379946 5:7174063-7174085 GTCCTGGACTCTTTTTTGGTTGG - Intergenic
986544028 5:8875640-8875662 TTCCTTGCCCCTTTAGAAGTTGG + Intergenic
986620845 5:9672453-9672475 GTCCTTGCCCACTTTTTGATGGG - Intronic
987415737 5:17660204-17660226 GTCCTGGGCCTTTTTTTGGTTGG + Intergenic
987530890 5:19118005-19118027 GTCCTGGGGCTTTTTGTGGTTGG - Intergenic
994715712 5:103319090-103319112 TTCCTTGCCCATTTTGAAGTTGG + Intergenic
994962690 5:106625407-106625429 GTCCTGGACTCTTTTTTGGTTGG + Intergenic
995307384 5:110669496-110669518 GTCCTTGACTTTTTTTTGGTTGG - Intronic
995374347 5:111456997-111457019 GTCAGTGCCACTTTTGTGCTGGG + Intronic
997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG + Intronic
998510867 5:142712955-142712977 CTCCTTCCCGCTTTTGTGGGAGG - Intergenic
1002352115 5:178590411-178590433 GTCCCTGCTCCTTTTCTGGCAGG - Exonic
1002537303 5:179883892-179883914 GGCCTTTCCCCTGCTGTGGTCGG + Intronic
1002545297 5:179938907-179938929 ATCCTTGACTCTTTAGTGGTAGG - Intronic
1004821623 6:19373858-19373880 CTCAGTGCCTCTTTTGTGGTGGG - Intergenic
1005723553 6:28626550-28626572 GTCCTTCGCCCATTTTTGGTGGG - Intergenic
1006835960 6:36999013-36999035 GTGCTGGCCCCTTCTGTGGAAGG - Intergenic
1011128063 6:84028264-84028286 GTCCTGGGCCCTTCTGGGGTTGG - Intergenic
1012981419 6:105834034-105834056 GTTCTTTTCCCTTTTGTGGCTGG + Intergenic
1015121994 6:129710074-129710096 GTCCTTGCCGCTGGGGTGGTAGG + Exonic
1016937559 6:149458588-149458610 GTCCTTGCCTCTTCTGTGCCGGG - Intronic
1017684833 6:156901690-156901712 GTCTTTTCCCCTTTTGAGATTGG + Intronic
1017753174 6:157507764-157507786 TTCCTTGCCCCTCTTCTGGATGG + Intronic
1018791279 6:167150024-167150046 CTCCTTGCCACTTTTGTCTTTGG - Intronic
1020052319 7:5089997-5090019 GCCCTTTCCCCTTTAATGGTGGG - Intergenic
1020358102 7:7299771-7299793 GTCCTGGGCCTTTTTTTGGTTGG + Intergenic
1022026167 7:26449728-26449750 GTCCTTGCCTCTTTGCTGCTTGG + Intergenic
1023981878 7:45075173-45075195 GTGCCTGCCCCTTCTGTGCTGGG + Intronic
1024056356 7:45662032-45662054 CTCCTTGCCCCTTGTGTGTTTGG + Intronic
1024296703 7:47849516-47849538 GTCCTTGCCCACTTTTTGATGGG - Intronic
1027276616 7:76563823-76563845 GTCCTGGACCTTTTTTTGGTTGG + Intergenic
1028218019 7:88159271-88159293 GTCCTGGCCTTTTTTTTGGTTGG - Intronic
1030271300 7:107671034-107671056 GCCCTTTCTCCTTTTTTGGTGGG - Intronic
1031105374 7:117535362-117535384 GTCCTTGCCCTTTTTCAGGCTGG + Exonic
1031236484 7:119185198-119185220 GTGCATGCCCCTTTTGTTGCAGG - Intergenic
1032124388 7:129182119-129182141 GTCTTTGCCCCCTTTTTAGTTGG + Intergenic
1033400867 7:141023296-141023318 GTCCTGGACCCTTTTTTTGTTGG + Intergenic
1037579076 8:20234044-20234066 GACCTTACCCCTTTTTTGGGGGG + Intergenic
1037841414 8:22247908-22247930 GTCCATGCCCCTCTCGTTGTCGG - Exonic
1041051131 8:53935621-53935643 GTCCTGGGCCTTTTTTTGGTTGG - Intronic
1042056149 8:64766688-64766710 GTCCTTGCCCCTTATGTCAAGGG + Intronic
1042219527 8:66460076-66460098 ATACTTGCCCCTTGTGTGGTAGG - Intronic
1044903741 8:96977161-96977183 GTCCTTAGCCCTTTTTTGATGGG - Intronic
1046383558 8:113480494-113480516 GTCCTTTCCACTTTTGGGCTGGG + Intergenic
1047613436 8:126543282-126543304 GTCCTTGCCCTTATTCTAGTGGG + Intergenic
1047728733 8:127707888-127707910 ATCCTTGACTCTTTTGAGGTTGG - Intergenic
1051068808 9:13137423-13137445 GTCCTTGCCCCTCCTGGGCTGGG - Intronic
1053066717 9:35074297-35074319 GTCCTTGGACCTATTGTGGGTGG - Intronic
1055819174 9:80240983-80241005 GTCATTGCTCCCTTTGTGGAAGG + Intergenic
1056278918 9:85020578-85020600 GTCCTTGCTCCTCTGGTGATGGG + Intronic
1057034647 9:91802860-91802882 TTTGTTGCCCATTTTGTGGTTGG - Intronic
1058652418 9:107189103-107189125 GGACTTGTCCCTTTTGTGATAGG + Intergenic
1058737272 9:107905236-107905258 TCCCTAGCCCCTTCTGTGGTTGG + Intergenic
1059407815 9:114112764-114112786 GACCTTACCCATTTGGTGGTGGG + Intergenic
1060934123 9:127506003-127506025 GTCCCTGTCCCTCTGGTGGTTGG - Exonic
1061664582 9:132153115-132153137 GGCCTTTCCCCCTTTGAGGTGGG + Intergenic
1061678646 9:132231847-132231869 GTCCCTGCCTCTCTTGGGGTGGG + Intronic
1061724567 9:132575071-132575093 CTCCTTGCCCCATTTGCTGTGGG + Intergenic
1062117381 9:134816727-134816749 GTCCCTGCCCAGGTTGTGGTGGG + Intronic
1062393878 9:136344880-136344902 GGCCTTGCCCCTTCTCTGCTGGG - Intronic
1185721592 X:2386789-2386811 GTCCTTGCTTCTTTTGTGTGTGG + Intronic
1185820315 X:3196736-3196758 GTATTTGTCCTTTTTGTGGTTGG - Intergenic
1187633466 X:21201076-21201098 GTCCTTGCCCATTTTTTAATTGG - Intergenic
1188290974 X:28388442-28388464 GTCCTGGACTCTTTTTTGGTTGG + Intergenic
1189570537 X:42291228-42291250 CTTCTTGGCCCTTTTGTGGTTGG + Intergenic
1189946568 X:46186758-46186780 GTCCATGCCCCTTTTGTCAAAGG + Intergenic
1190507165 X:51137580-51137602 GTGCTTCCTCCTTTGGTGGTGGG - Intergenic
1191704631 X:64081488-64081510 GTCCTGGACCCTTTTTTAGTTGG + Intergenic
1191874248 X:65778854-65778876 GTCCTGGCCTTTTTTTTGGTTGG - Intergenic
1193670850 X:84384352-84384374 GTCTTTGCCCATTTTGTATTGGG + Intronic
1193874904 X:86850249-86850271 GTCTTTGCCCACTTTTTGGTGGG + Intergenic
1194021691 X:88699200-88699222 GTCCTGGGCCCTTTTTTTGTTGG + Intergenic
1194495821 X:94615783-94615805 GCCCTGGCCGCTTTTGTGGCTGG + Intergenic
1198776877 X:140189043-140189065 GTCCTTCCCACTTTTTTGGTGGG - Intergenic
1199268569 X:145856407-145856429 GTCATTGTCCCTGATGTGGTAGG + Intergenic
1201262252 Y:12170939-12170961 GTCCTGGACTCTTTTTTGGTCGG + Intergenic
1201590446 Y:15609435-15609457 GTCCTTGTCTCATTTGGGGTTGG - Intergenic