ID: 926142721

View in Genome Browser
Species Human (GRCh38)
Location 2:10377824-10377846
Sequence CACCGAGGGGGGCCAGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 235}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926142703_926142721 5 Left 926142703 2:10377796-10377818 CCCCATCCCCATCCCCAGGGTGG 0: 1
1: 0
2: 9
3: 88
4: 649
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142707_926142721 -1 Left 926142707 2:10377802-10377824 CCCCATCCCCAGGGTGGTGAGCC 0: 1
1: 0
2: 1
3: 24
4: 227
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142705_926142721 4 Left 926142705 2:10377797-10377819 CCCATCCCCATCCCCAGGGTGGT 0: 1
1: 0
2: 1
3: 41
4: 348
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142700_926142721 12 Left 926142700 2:10377789-10377811 CCAGAATCCCCATCCCCATCCCC 0: 1
1: 0
2: 24
3: 125
4: 1027
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142709_926142721 -3 Left 926142709 2:10377804-10377826 CCATCCCCAGGGTGGTGAGCCAC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142706_926142721 3 Left 926142706 2:10377798-10377820 CCATCCCCATCCCCAGGGTGGTG 0: 1
1: 0
2: 5
3: 60
4: 497
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142708_926142721 -2 Left 926142708 2:10377803-10377825 CCCATCCCCAGGGTGGTGAGCCA 0: 1
1: 1
2: 1
3: 26
4: 280
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142713_926142721 -9 Left 926142713 2:10377810-10377832 CCAGGGTGGTGAGCCACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 121
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142710_926142721 -7 Left 926142710 2:10377808-10377830 CCCCAGGGTGGTGAGCCACCGAG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235
926142711_926142721 -8 Left 926142711 2:10377809-10377831 CCCAGGGTGGTGAGCCACCGAGG 0: 1
1: 0
2: 1
3: 10
4: 106
Right 926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG 0: 1
1: 0
2: 0
3: 19
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926142721 Original CRISPR CACCGAGGGGGGCCAGGCAC GGG Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900163644 1:1236188-1236210 CACCGAAGAGCGCCGGGCACAGG - Intergenic
900183341 1:1322021-1322043 CACCCAGCGGGGGCAGGAACAGG - Intronic
900250605 1:1666772-1666794 CACTGTGGGAGGCCGGGCACGGG + Intronic
900261268 1:1730999-1731021 CACTGTGGGAGGCCAGGCACGGG + Intronic
900407191 1:2497925-2497947 CCCACAGAGGGGCCAGGCACAGG - Intronic
900471345 1:2856549-2856571 CTCCAAGGGGTGCCAGCCACCGG - Intergenic
900695432 1:4006566-4006588 CAGCGAGAGAGGCCAGGCAAAGG - Intergenic
900876717 1:5348145-5348167 CACTTAGGGGTGCCAGGGACCGG - Intergenic
900923024 1:5685635-5685657 CTCCGGGCCGGGCCAGGCACTGG + Intergenic
901463205 1:9404109-9404131 GACCGAGGGTGGCCCGGCAAGGG + Intergenic
904054251 1:27659839-27659861 CCCCGCGGCGGGCCGGGCACAGG - Intergenic
905865906 1:41376526-41376548 CACTGAGGGGTGCCAGGGAGAGG - Intronic
905874624 1:41423995-41424017 CACCGGGGCTGGCCAGGCAGGGG - Intergenic
906607749 1:47183465-47183487 GACCGAGGGGGCCCAGGCTGGGG - Intergenic
907118366 1:51989431-51989453 CAAGGAGGGGACCCAGGCACTGG - Intronic
907515060 1:54988533-54988555 CACCCATGGGGGCCAGGTGCTGG - Intronic
912710745 1:111948175-111948197 CAGAGAGGGAGGCCACGCACAGG - Intronic
912863632 1:113237242-113237264 CACCCAGAGGAGCCAGGCAGAGG - Intergenic
913186473 1:116373902-116373924 CAGGGAGGGGAGCCAGGCTCAGG - Exonic
922739437 1:228007056-228007078 CGCCGGGGGGGGCCGGGCCCTGG - Exonic
924741260 1:246795383-246795405 CAGGGCAGGGGGCCAGGCACAGG - Intergenic
1063245408 10:4212734-4212756 CACCGAGAGGGGACAAGCCCTGG + Intergenic
1067723022 10:48743864-48743886 CACCCAGGGATGCCAGGCCCAGG - Intronic
1067785315 10:49241565-49241587 AACCTAGGAGGGCCAGGCTCAGG + Intergenic
1069790846 10:71019645-71019667 CACCTAGGGGGGCCTGCCAAAGG + Intergenic
1072699885 10:97633155-97633177 CACCGCGGGGGTCGAGGCCCGGG - Intronic
1072934656 10:99700602-99700624 CACCGAGGGAGGCCAATGACAGG + Intronic
1073136749 10:101224557-101224579 GACCCAGCGGGGCCAGGCCCAGG + Intergenic
1075088885 10:119431746-119431768 CACAGCAGGGAGCCAGGCACTGG - Intronic
1076512409 10:131022095-131022117 GACCGAGGCTGGCCAAGCACAGG + Intergenic
1076658244 10:132038308-132038330 CCCCGAGGGAGCCCACGCACAGG + Intergenic
1076674788 10:132142263-132142285 CCCAGAGCGGTGCCAGGCACAGG + Intronic
1076870026 10:133188604-133188626 CGCGGAGGCAGGCCAGGCACAGG - Exonic
1077124622 11:926806-926828 CACCCCGAGGGGACAGGCACGGG - Intronic
1077158194 11:1100829-1100851 CGGCGTGGGGGTCCAGGCACTGG - Intergenic
1077296199 11:1827318-1827340 CACCGAGTGGGGGCAGACGCAGG - Intergenic
1083227810 11:61295495-61295517 CACCGACAGGGGCCATGCCCGGG - Intergenic
1083379224 11:62251262-62251284 CACTGAGGTGGCCTAGGCACTGG + Intergenic
1083420072 11:62547393-62547415 CACCGCGGTGCGCGAGGCACTGG - Intronic
1083666057 11:64275372-64275394 CAGCTAGGTGGGCCAGGCCCTGG + Intronic
1083922514 11:65788212-65788234 CACAGCGGAGGGCCAGGCCCGGG + Intronic
1083935064 11:65865734-65865756 CACCATGAGGGGCCAGGCAGAGG - Intronic
1084174795 11:67417562-67417584 CCCCGAGGGGGCCGAGGCCCGGG + Exonic
1084273614 11:68041234-68041256 CACGGATGGGGGCCAGTCAGGGG - Intronic
1084414154 11:69021190-69021212 CACAGAGGGGGTCACGGCACCGG - Intergenic
1085053299 11:73390686-73390708 GACCCTTGGGGGCCAGGCACAGG - Intronic
1085387441 11:76165114-76165136 CACGGAGGGGACACAGGCACGGG + Intergenic
1088968478 11:114749926-114749948 CATGGAGGGTGGCCAGGCATGGG - Intergenic
1090229876 11:125093995-125094017 CACAGATGGGGAACAGGCACGGG - Intergenic
1090347482 11:126082911-126082933 CACAGGGGAGGGCCAGGCCCTGG + Intergenic
1091622865 12:2102437-2102459 CACTGAGGGGACCCAGACACTGG - Intronic
1092290076 12:7155073-7155095 CACCGTGTGGGGCCATGGACAGG + Intronic
1096652178 12:53067261-53067283 CACCCAGGGAGGGCAGGCAGGGG + Intronic
1096726298 12:53565780-53565802 AAGAGAAGGGGGCCAGGCACAGG - Intronic
1097895813 12:64824379-64824401 CACCAAGGGGCGCCAGTCTCAGG - Intronic
1099764916 12:86970941-86970963 CACCTATGGGGGCAGGGCACAGG + Intergenic
1101533325 12:105594762-105594784 CACCCAGGGGGGTAAGGGACTGG - Intergenic
1101777323 12:107806455-107806477 CACAGAGAGGGACCGGGCACAGG + Intergenic
1102983272 12:117259128-117259150 CACCTAGGTGGGCAGGGCACAGG + Exonic
1103567766 12:121825431-121825453 CATGGAGGGGTGCCAGGCAGAGG + Intronic
1104902582 12:132197394-132197416 CACCCAGGGGGGCCGGGAAGGGG + Intronic
1104973570 12:132542148-132542170 CACAGGGAGGGGCCAGGAACTGG + Intronic
1108409652 13:50133489-50133511 CACCGAGGGGCGCTCGGCAGCGG + Intronic
1109145425 13:58773543-58773565 CACGGAGGGGGGTGAGGCTCAGG - Intergenic
1110056365 13:70978708-70978730 CACAGAGGGAGGCAAGGAACAGG - Intergenic
1114186701 14:20408091-20408113 TAGAGAGGGTGGCCAGGCACCGG + Exonic
1117988458 14:61411221-61411243 CACCGAGGAGGACAAGGGACTGG - Intronic
1118846007 14:69548247-69548269 CGCCAGGGGGCGCCAGGCACCGG + Intergenic
1119185063 14:72634830-72634852 CACCCAGGGGGGCCTGGGAAGGG - Intronic
1119898736 14:78242641-78242663 CAGCCAGGGAGGCCAGGGACAGG - Intronic
1120523922 14:85555843-85555865 CTCAGAGAGAGGCCAGGCACAGG - Intronic
1121518516 14:94569954-94569976 AACCCAGGAGGGCCAGGCAGAGG - Intronic
1122439069 14:101717847-101717869 CTCTGAGGGAGGCCAGGAACAGG - Intergenic
1122612783 14:102997142-102997164 CACGGAGGGGGCCCGAGCACAGG + Intronic
1122922567 14:104886046-104886068 CCCCCAGGGGAGCCCGGCACCGG - Exonic
1122930809 14:104932384-104932406 GCCCCAGGGTGGCCAGGCACGGG + Intronic
1127961168 15:63891978-63892000 CCCCGAGGGAGGGCAGGGACTGG - Intergenic
1129231158 15:74197847-74197869 CACCCAGGGGGGCCTGACGCAGG - Intronic
1129391252 15:75222050-75222072 CAGCGAGGTGAGACAGGCACAGG - Intergenic
1129731308 15:77934224-77934246 CAGCGAGGTGAGACAGGCACAGG + Intergenic
1129997170 15:80016748-80016770 CACGGAGGGCGGGCAGGCTCAGG - Intergenic
1130411738 15:83653872-83653894 CGCCGTGTGGGGCCAGGCCCGGG - Intergenic
1131750770 15:95505660-95505682 CACTGGGGTGGGGCAGGCACAGG + Intergenic
1132580094 16:680721-680743 CACCGGGGAGGGCCGGGCCCGGG + Intronic
1132602356 16:779373-779395 CACCCTGTGGGGCCAGGCTCTGG + Intronic
1132688596 16:1172444-1172466 GACGGAGGCGGGCCAGGCCCAGG - Intronic
1132764689 16:1528213-1528235 CACCGAGCAGGGACAGGCAGAGG + Intronic
1133004166 16:2868531-2868553 CACCGGGGGGCGACAGACACAGG - Intergenic
1133291973 16:4728381-4728403 CACTGAGGGCTGCCAGGCAATGG - Intronic
1135989425 16:27208701-27208723 CACCCAGGGAGGCCAGGGATGGG + Intronic
1136245826 16:28975209-28975231 AACCCCGGGGTGCCAGGCACTGG - Exonic
1136392820 16:29976109-29976131 CACGGAGGGGTGCCACCCACTGG - Intronic
1138720397 16:59072805-59072827 CACCTCTGGGGGCAAGGCACAGG + Intergenic
1139404415 16:66706784-66706806 CACCCCCCGGGGCCAGGCACTGG + Intergenic
1139657021 16:68395021-68395043 CACCCAGGGGGGCTAGCCAAGGG - Intronic
1141198471 16:81879162-81879184 CAGTGAGGGGGGCCACACACTGG + Intronic
1141436584 16:84003044-84003066 CGGAGTGGGGGGCCAGGCACGGG + Intergenic
1141572733 16:84944013-84944035 CAAAGAGGGGAGCCAGCCACAGG - Intergenic
1141705435 16:85661958-85661980 CATCGAGGCAGGACAGGCACGGG - Intronic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1142615880 17:1134841-1134863 CTCCGAGGAGTGCCTGGCACAGG + Intronic
1143020933 17:3916898-3916920 CACCGAGGTTGACCGGGCACAGG - Intergenic
1143580741 17:7824252-7824274 CAGCGATGGGGGCCTGGCCCTGG - Exonic
1143759068 17:9088138-9088160 CACCCAGTGGGGACAGGCAGGGG + Intronic
1147599820 17:41738761-41738783 GACCTGGGGGGGACAGGCACCGG + Intergenic
1150227931 17:63533852-63533874 GGCCGAGGGAGGTCAGGCACGGG - Intronic
1153688307 18:7567590-7567612 CGCCGAGTGGGGCCAGGGACAGG + Exonic
1154076975 18:11212940-11212962 CACAGAGGGGGAGCTGGCACTGG + Intergenic
1160492901 18:79352722-79352744 CTCAGAGGAGGGCCAGGCTCTGG + Intronic
1160590309 18:79940930-79940952 CCCCGGGGGAGGGCAGGCACAGG + Intronic
1160780110 19:873760-873782 CCCCGGGGGGGGGCAGGCAGTGG - Intronic
1160899252 19:1419033-1419055 CTCTGAGGAGGGCCAGGCAGTGG - Intronic
1160925072 19:1540399-1540421 AACAGAGGGGGCCCAGGGACAGG - Intergenic
1161314782 19:3612726-3612748 CCCCGAGGGGGTCCTGGCCCAGG + Intronic
1161596187 19:5152205-5152227 CACAGAGTGGGCACAGGCACTGG - Exonic
1163007194 19:14404460-14404482 CACCGAGGGCTGCCAGGTGCTGG + Exonic
1163519696 19:17784602-17784624 CCCCAAGGGGGTCCAGTCACAGG - Intronic
1163528412 19:17835213-17835235 CTCCTAAGGGGGCCAGACACAGG + Exonic
1163597060 19:18226363-18226385 CCCCGAGGGGAGCCGGGCCCGGG + Intronic
1165139577 19:33690645-33690667 CACCTGTGGGGGCCCGGCACAGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165423643 19:35733904-35733926 CACCCAGCTGAGCCAGGCACAGG - Intronic
1165740725 19:38203748-38203770 CACCTGGCGGGTCCAGGCACAGG - Intronic
1166654359 19:44599347-44599369 CACCAAGGTGGGCAAGGCACTGG + Intergenic
1168011686 19:53538316-53538338 CTCCGAGGGGAGACGGGCACGGG + Intronic
925012969 2:499874-499896 CACCAAGGGGGGTCCTGCACAGG - Intergenic
925878564 2:8332001-8332023 CACCGAGCAAGGCCAGGCCCAGG + Intergenic
926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG + Intronic
926167517 2:10530763-10530785 AACCAAGGAGGGCCAGGCTCTGG + Intergenic
927239825 2:20911477-20911499 CACCGGGGAGTGCCAGGCAGTGG - Intergenic
927826148 2:26311516-26311538 CAAAGAAGGGTGCCAGGCACAGG - Exonic
930089455 2:47521152-47521174 CACCGAGCGCGGCCAGGCGGCGG + Exonic
933285225 2:80378064-80378086 CAGAGAAGGGGGCCAGGCGCAGG + Intronic
934574596 2:95392033-95392055 CCCAGGGAGGGGCCAGGCACAGG + Intergenic
935116549 2:100142312-100142334 CACCGAGATGGTCCAGGCCCTGG - Intronic
935254878 2:101300873-101300895 CTGCAAGGGGTGCCAGGCACGGG + Intronic
936155331 2:110043146-110043168 CACGGAGGGGAGCCCAGCACAGG - Intergenic
936189349 2:110328267-110328289 CACGGAGGGGAGCCCAGCACAGG + Intergenic
937221322 2:120344617-120344639 CACCGACGGGTTCCAGGCGCTGG - Intergenic
937297514 2:120818487-120818509 GGCCGAGCTGGGCCAGGCACTGG + Intronic
938971448 2:136437021-136437043 CACAGTGGGGGTCCAGCCACAGG - Intergenic
941221527 2:162787438-162787460 CACAGAGGCTGGCCTGGCACCGG - Intronic
942070201 2:172309221-172309243 CACCTATGTGTGCCAGGCACAGG - Intergenic
947733060 2:232441590-232441612 AACCCAGGGGGGCCCGGCCCAGG - Intergenic
948836971 2:240630561-240630583 CACCGACGTGGGGCAGGCAGAGG + Exonic
1169004708 20:2196903-2196925 CATGGAGGAGGGCCTGGCACTGG + Intergenic
1169130927 20:3166093-3166115 CACTGAGGGGTGCCAGGTGCTGG + Exonic
1172621314 20:36320135-36320157 CACAGAGGGGGGCCTGGGAGAGG - Intronic
1173251587 20:41366648-41366670 CACCGCGCGGGGCCGGGCAGAGG - Exonic
1174549952 20:51354999-51355021 CACTGAGGGCTACCAGGCACCGG - Intergenic
1175669519 20:60890041-60890063 GGCTGAGGGGTGCCAGGCACAGG + Intergenic
1175727894 20:61332011-61332033 CCCAGAGCAGGGCCAGGCACAGG + Intronic
1175764191 20:61581656-61581678 CACGGAGGCAGCCCAGGCACAGG - Intronic
1176138120 20:63533934-63533956 CTCCGAGAGTGGCCAGGCCCGGG + Intronic
1176161254 20:63650115-63650137 CACTGCGGGGGGCCAGGCGCGGG - Intronic
1176273214 20:64247238-64247260 CAGGCAGGGGTGCCAGGCACAGG - Intergenic
1176332270 21:5559740-5559762 CACCGATGGGGGGGAGGCTCAGG + Intergenic
1176395487 21:6261211-6261233 CACCGATGGGGGGGAGGCTCAGG - Intergenic
1176441670 21:6727893-6727915 CACCGATGGGGGGGAGGCTCAGG + Intergenic
1176465932 21:7054962-7054984 CACCGATGGGGGGGAGGCTCAGG + Intronic
1176489493 21:7436740-7436762 CACCGATGGGGGGGAGGCTCAGG + Intergenic
1179644527 21:42767339-42767361 CACTGAGGCCGGCCAGGCACAGG + Intronic
1179725308 21:43338567-43338589 CAGGGAGGCGGGCCATGCACAGG - Intergenic
1180028209 21:45181037-45181059 CACCCTGGGGTGCCAGACACTGG - Intronic
1181236758 22:21451749-21451771 CAATGAGGGGTCCCAGGCACTGG - Intergenic
1181475480 22:23165312-23165334 CACCAAGGAGAGCCAAGCACAGG - Intergenic
1181897830 22:26126376-26126398 CACCCAGGAAGGCCAGGCCCTGG + Intergenic
1182660838 22:31924106-31924128 CACCCATGGTGGCCAGGCACAGG + Intergenic
1183640924 22:39091930-39091952 CACCTAGGAGGGGCAGGCCCAGG + Intergenic
1184091465 22:42295100-42295122 CAGCGTGGGGGGCAGGGCACAGG + Intronic
1184585685 22:45446560-45446582 CACCAAGCAGGGACAGGCACTGG + Intergenic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
1184936208 22:47724202-47724224 CAGCGAGGGGGACAAGGCATGGG - Intergenic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185299154 22:50070469-50070491 CACCGAGCGGGGCCAGGGCCTGG - Intronic
950282299 3:11719172-11719194 GACCGCGGGGTGCCAGGCGCGGG + Intronic
950441959 3:13015616-13015638 CGCAGAGGCAGGCCAGGCACTGG - Intronic
950548903 3:13654913-13654935 CAGGGAGGTGGGCCAGGCACTGG - Intergenic
951061148 3:18208648-18208670 CTCTGAGGGGGTCCAGACACAGG - Intronic
953980750 3:47411806-47411828 CACCGAGAGGGGCCAGCCCATGG + Exonic
960966847 3:123111376-123111398 CCCAGAGGCGGGCCAGGCTCTGG - Intronic
961360209 3:126362358-126362380 CACATGGGGGGGCCAGGCAGTGG - Intergenic
961830410 3:129620186-129620208 CACCGAGGGTGGGCAGACCCAGG + Intergenic
964291203 3:155182761-155182783 GACAGAGGGGATCCAGGCACTGG - Exonic
968438820 4:611162-611184 GACCCAGGTGGGCCAGGCAGAGG + Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968603614 4:1521232-1521254 CACCGGGAGGGGCCGGGCATGGG - Intergenic
968701218 4:2059118-2059140 CAGCGCGAGGGGCCCGGCACGGG - Intergenic
969647081 4:8437484-8437506 CACCTGGCGGGGCCAGGCAGTGG - Intronic
970594086 4:17584119-17584141 CACAGTGGGGGCCCTGGCACTGG + Intronic
972621368 4:40750532-40750554 CAACGAAGGGGGCCACCCACAGG + Intronic
972725631 4:41745005-41745027 CAGCGAGGTGGGACAGGCAAGGG + Exonic
983715394 4:170776186-170776208 CACTGAGGGTGGCTTGGCACAGG + Intergenic
984652965 4:182289339-182289361 CAGAGAGCGGGGCCAGGAACAGG - Intronic
985687142 5:1288596-1288618 CACCCAAGGGGGCCAAGCAGAGG + Intronic
987118084 5:14742264-14742286 TGCCGATGGTGGCCAGGCACAGG - Intronic
989465778 5:41753627-41753649 CACCTAGGAGGGCCACACACTGG - Intronic
991221615 5:64225471-64225493 GACGGAGGGCGGCCAGGCAGAGG - Intronic
995269572 5:110205554-110205576 CACCTATGGGGGCCTGCCACAGG + Intergenic
998463136 5:142324063-142324085 CACCGAGCTGTGCCAGGCCCCGG - Intronic
999267673 5:150277416-150277438 CAGCGAGGGGGGCTCTGCACAGG + Intronic
1000622955 5:163505790-163505812 CGCCGAGGGGGACGAGCCACCGG + Intronic
1001605741 5:172958756-172958778 GACCCGGCGGGGCCAGGCACGGG + Intronic
1002199924 5:177521915-177521937 CAGAGAGGGTGGCCAAGCACAGG + Intronic
1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG + Intergenic
1007409471 6:41653630-41653652 CTCTGAGTGGGGCCAGGCCCAGG + Exonic
1007431312 6:41779106-41779128 CACCGACGGGGGCACGGCGCGGG + Intronic
1008648925 6:53544440-53544462 CAGCGCGGGCGGCCAGACACGGG + Intronic
1012510350 6:99994121-99994143 CAAAGCGGGGGTCCAGGCACAGG + Exonic
1013236133 6:108199041-108199063 CACCTAGGAGGGCCAGGCAGTGG + Intergenic
1013308696 6:108873438-108873460 CACCGTGAGGGGGCAGGCCCAGG - Intronic
1013406656 6:109849714-109849736 CACCTAGGGGGGCCTGCCAAAGG - Intergenic
1015443301 6:133272653-133272675 CACCTATGGGGGCCTGGCAAAGG + Intronic
1018326206 6:162672023-162672045 CAGAGAGTGGGGCCAGACACTGG + Intronic
1019559574 7:1649254-1649276 CACAGCTGGGGGCCAGGCACAGG - Intergenic
1020243096 7:6410446-6410468 CACCAAGGCGGACCAGGCACAGG + Intronic
1023017454 7:35982287-35982309 CACCAAAGGGGGCCAGGCCCAGG - Intergenic
1024044928 7:45579793-45579815 CACTGTGGGGGGCCATGCCCAGG - Intronic
1025733808 7:64129413-64129435 GACCGATGGTGGCCAGGGACTGG + Intronic
1026797967 7:73377971-73377993 CCCCGAGGAGGCCCGGGCACAGG - Intergenic
1029250819 7:99234885-99234907 CACCGCGCCCGGCCAGGCACTGG + Intergenic
1029592989 7:101519612-101519634 CAGGGAGCGGGGTCAGGCACTGG + Intronic
1029643891 7:101839261-101839283 CACCGAGGGTGACCAGCCCCAGG - Intronic
1032129523 7:129216641-129216663 GACGAAGGGGGGCCAGGCAAAGG - Intergenic
1035249512 7:157587905-157587927 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249522 7:157587934-157587956 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249532 7:157587963-157587985 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249542 7:157587992-157588014 CACCGCGGGAGCCCAGGCACGGG - Intronic
1035249552 7:157588021-157588043 CACCACGGGAGCCCAGGCACGGG - Intronic
1035287590 7:157816238-157816260 CAGGGAGGCGGGGCAGGCACGGG - Intronic
1035749127 8:1983412-1983434 CACGGAGCGGTGGCAGGCACAGG - Intronic
1036776207 8:11614417-11614439 CACCTGGGGGGGCCGGACACGGG - Intergenic
1039903071 8:41766996-41767018 CCCCGAGGGGGGCCGGGCCCTGG - Intronic
1040604813 8:48921336-48921358 CATCGCGGCGGGCCAGGCTCGGG + Exonic
1042627702 8:70777116-70777138 CACACAAGGGGGCCAGTCACGGG - Intronic
1044858021 8:96495061-96495083 CACCGCGGGGCGTCAGGGACGGG + Intronic
1045815213 8:106270480-106270502 CTCGGAGAGGCGCCAGGCACAGG - Intronic
1048209139 8:132440476-132440498 CACTGTGCGGGGCCAGGCTCTGG - Intronic
1049427655 8:142544542-142544564 CTCAGACGGCGGCCAGGCACAGG + Exonic
1049572976 8:143378212-143378234 CAGGGAAGGAGGCCAGGCACAGG + Intronic
1053292282 9:36889127-36889149 CACCAAGGGGGCCCAGGTTCAGG - Intronic
1055802307 9:80051982-80052004 CACTGAGGCAGGCCTGGCACTGG - Intergenic
1057797303 9:98168006-98168028 CACAGAGGTGGCCCAGGCCCCGG + Intronic
1060299131 9:122363870-122363892 CACCTACGTTGGCCAGGCACGGG + Intergenic
1062287142 9:135778319-135778341 CACAGAGCTGGGCCAGGCAGGGG - Intronic
1203429825 Un_GL000195v1:80592-80614 CACCGATGGGGGGGAGGCTCAGG - Intergenic
1187401872 X:18967306-18967328 CACAGAGGCTGGCCAGTCACAGG + Intronic
1190340312 X:49290840-49290862 CACTGAGCAGTGCCAGGCACAGG + Intronic
1191221218 X:57989985-57990007 GACTGAGGGGGGCTGGGCACTGG + Intergenic
1191880228 X:65838152-65838174 GACTGAGCTGGGCCAGGCACAGG - Intergenic
1197693054 X:129523138-129523160 CCCTCAGAGGGGCCAGGCACAGG + Intronic
1198395395 X:136214323-136214345 CAACCAGGCCGGCCAGGCACTGG + Intronic
1199413098 X:147548371-147548393 CACCGGGGGGGGACAGGCCCCGG - Intergenic
1200173295 X:154095024-154095046 CACAGAGGCAGGGCAGGCACGGG + Intronic