ID: 926145681

View in Genome Browser
Species Human (GRCh38)
Location 2:10395996-10396018
Sequence CAGGCAGAGAAGAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1387
Summary {0: 1, 1: 1, 2: 11, 3: 157, 4: 1217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926145674_926145681 -9 Left 926145674 2:10395982-10396004 CCATGCCCGGGGAGCAGGCAGAG 0: 1
1: 0
2: 2
3: 38
4: 367
Right 926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG 0: 1
1: 1
2: 11
3: 157
4: 1217
926145666_926145681 28 Left 926145666 2:10395945-10395967 CCAGAGGCTGCAGGTTCACGGAG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG 0: 1
1: 1
2: 11
3: 157
4: 1217
926145672_926145681 -4 Left 926145672 2:10395977-10395999 CCAATCCATGCCCGGGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG 0: 1
1: 1
2: 11
3: 157
4: 1217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926145681 Original CRISPR CAGGCAGAGAAGAGGGAGGC GGG Intronic
900144907 1:1154222-1154244 CAGCCAGGGAAGAGTGAGACAGG - Intergenic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900360232 1:2284730-2284752 CAGGCAGGGAAGAGTCAGGGAGG + Intronic
900404186 1:2485341-2485363 CAGGCAGCGGAGGGGAAGGCCGG + Intronic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900681763 1:3920394-3920416 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
900702286 1:4055787-4055809 CAGGGAGAGAAACAGGAGGCAGG - Intergenic
900732144 1:4269075-4269097 CAGGGAGAGGAGAGGCAGCCAGG + Intergenic
900748313 1:4376704-4376726 CAGGCAGGGAGGAGGAAGGAAGG + Intergenic
900869497 1:5291919-5291941 CAGCCAGAGAAGAGGGCCGTGGG - Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
900889968 1:5442453-5442475 TACACGGAGAAGAGGGAGGCAGG + Intergenic
900930514 1:5734217-5734239 ATGGCAGAGTAGAGGAAGGCAGG + Intergenic
901138940 1:7015467-7015489 CATTCAGAGGAGAGGCAGGCTGG - Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902359141 1:15932562-15932584 CAGGCAGGGGAGAGGGAATCTGG + Exonic
902678934 1:18029528-18029550 CAGGCACAGATGAGAGAGACAGG - Intergenic
902793939 1:18788029-18788051 GAGGAAGAGAAGGGGGAGGGAGG + Intergenic
903130020 1:21272946-21272968 CAGGCAGGGAAGAAGCAGGGAGG + Intronic
903218319 1:21855122-21855144 CAGGCAGCCAAGAGGACGGCAGG + Intronic
903264877 1:22152029-22152051 AAGGCAGAAAGGAGGGAGGGAGG - Intergenic
903535347 1:24063038-24063060 CAGGCAGGGAGAAGGGAGGGAGG + Intronic
903565033 1:24258828-24258850 CAGGCAGAGGACAGGCAGGGAGG - Intergenic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
904036282 1:27560930-27560952 GAGGGAGGGAAGAGGGAAGCAGG - Intronic
904036534 1:27562030-27562052 CAGGCAGAGATGGGAAAGGCAGG + Intronic
904068865 1:27777186-27777208 GAGTCAGGGAAGAGGGAGGGTGG + Intronic
904236840 1:29122090-29122112 CGGGCGGAGAGGAGGGAGGGGGG + Intronic
904285056 1:29448698-29448720 GAGGCAGAGAAGGGGGAGGCTGG - Intergenic
904290587 1:29483339-29483361 CAGGTACAGAGGAGGGAGCCAGG + Intergenic
904370892 1:30046795-30046817 CAGGCATAGAGGAGGCAGTCGGG - Intergenic
904456223 1:30649796-30649818 CAGGCAGAGAGGAGGTGGGCAGG - Intergenic
904456498 1:30651380-30651402 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904456513 1:30651428-30651450 CAGGCAGGGAGGAGGTGGGCGGG - Intergenic
904456530 1:30651476-30651498 CAGGCAGGGAGGAGGTGGGCGGG - Intergenic
904456589 1:30651658-30651680 CAGGCAGGGAGGAGGTGGGCGGG - Intergenic
904456607 1:30651715-30651737 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904456614 1:30651734-30651756 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904456630 1:30651782-30651804 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904456642 1:30651820-30651842 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904456659 1:30651877-30651899 CAGGCAGGGAGGAGGTGGGCAGG - Intergenic
904604837 1:31692605-31692627 AAGGGAGAGAAGGGGGAGTCAGG - Exonic
904616372 1:31752405-31752427 CAGGCAGTGAGGAGGCAGGGTGG - Intronic
904644404 1:31955090-31955112 CAGGCAGGGAGGAAGGAGCCAGG + Intergenic
905101830 1:35531007-35531029 GTGGGAGACAAGAGGGAGGCAGG + Intronic
906261032 1:44390252-44390274 CAGGGAGAGAAGAGAGGGGTTGG + Intergenic
906290210 1:44614783-44614805 CAGGCAGGGACAAGGGAGGGAGG - Intronic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
906703557 1:47877447-47877469 AAGGGACAGAAGAGGGAGGGAGG - Intronic
906708724 1:47913673-47913695 AAGGAAGGGAAGAGGGAAGCAGG - Intronic
906740466 1:48177881-48177903 CAGGTAGGGAAGAGGGAGTGGGG + Intergenic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907289049 1:53401156-53401178 GAGGGAGAGAAGAGGGAGCAGGG + Intergenic
907303687 1:53502676-53502698 CAGGCAGAGATGAGAGGGGGAGG + Intergenic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907437523 1:54459060-54459082 CAGGCAGGAAGGAGGGAGGGAGG + Intergenic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907620694 1:55975420-55975442 GAGGCAGAAAAGAGGAAAGCTGG + Intergenic
907820670 1:57964814-57964836 AAGGAAGGAAAGAGGGAGGCAGG + Intronic
907893180 1:58656093-58656115 CAGGAAGAGAAATGGGAGGAAGG + Exonic
907981007 1:59480775-59480797 GAGGCAGGGAAAAGGGAGGGAGG + Intronic
908359923 1:63358858-63358880 CAGGGCGAGAAGTGGGAGGTGGG + Intergenic
908393278 1:63702780-63702802 AAGGCAGAGAGCAGGGGGGCTGG + Intergenic
908578283 1:65485409-65485431 AAGGCAAAGATGAGGGAGCCAGG + Intronic
908921178 1:69194632-69194654 AAGGCAGAGAAGGATGAGGCTGG - Intergenic
909024600 1:70468056-70468078 CAGGGAGAGAGCAGGCAGGCTGG - Intergenic
909533348 1:76706212-76706234 CAGGAAGAAAGGAGGGAGGAAGG - Intergenic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
911618334 1:100038543-100038565 CGGCCAGAGCAGAGGGCGGCAGG - Intronic
912196174 1:107399889-107399911 CAGGCAGAGATGAAGGAAGAGGG - Intronic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912566850 1:110593455-110593477 CAGGCAGAGACCAGGCAGGATGG - Intergenic
913343121 1:117780065-117780087 CAGGCAGAGATGGGGCAGGTAGG + Intergenic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
913647998 1:120879993-120880015 CAGGCAGGGAAAAGAGATGCTGG - Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
914960117 1:152197545-152197567 GAGGAAGAGAAGAGGGAGAAAGG - Intergenic
915489047 1:156241469-156241491 CAGGCACAGGGAAGGGAGGCAGG - Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915943733 1:160135323-160135345 CAGGCAGGGACCGGGGAGGCAGG + Intronic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916001538 1:160621187-160621209 CAGGCAGAGGCAATGGAGGCTGG + Intronic
916880574 1:169016372-169016394 GAGGCAGAGAAAAGCCAGGCTGG + Intergenic
917202534 1:172532929-172532951 CAGGCGGAGAAGCCGGAGGCAGG - Intronic
917216153 1:172680310-172680332 ATGGCAGAGAAGTGGGAGGAAGG - Intergenic
917505274 1:175621717-175621739 AAGGCAGAGAGGAAGGAGGGAGG - Intronic
917644681 1:177018416-177018438 CAAGCAAAGAAGAGGGCAGCTGG + Intronic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918108415 1:181433358-181433380 CAGGCAGAGATAAGGCAAGCTGG - Intronic
918114071 1:181482409-181482431 AATGCCGAGAAGAGAGAGGCAGG - Intronic
918488077 1:185050334-185050356 TAGGCAGAGAAGAGGCAAGTTGG - Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918732371 1:188013800-188013822 CAGGCAGAGGAGAGCGAGCGAGG + Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919495910 1:198267791-198267813 CAGGCAGAGGTGAGGGTGGTAGG - Intronic
919523790 1:198621972-198621994 GAGAGAGAGAAGAGGGAGGGAGG + Intergenic
919742742 1:200990547-200990569 ATGGAAGAGAAGGGGGAGGCAGG + Intronic
920074707 1:203327639-203327661 CTTTCAGAGAAGGGGGAGGCGGG + Intergenic
920116363 1:203624498-203624520 GAGGGAGGGAAGAGGGAGGGAGG + Intergenic
920187023 1:204166160-204166182 CAGGCAGAGAAGGGGTGGGAGGG - Intronic
920345166 1:205301637-205301659 CAGGCAGTGAGGACGGAGGGGGG + Intergenic
920366756 1:205452018-205452040 CAGGGAGAGATGAGGGGGCCTGG + Intronic
920418119 1:205812470-205812492 CAGGAACACAGGAGGGAGGCGGG - Intronic
920507843 1:206529254-206529276 CAGGCTGAGAAGAGAGCTGCCGG + Intronic
920647860 1:207816404-207816426 CAGGAAGAGAAAGCGGAGGCAGG + Intergenic
920917442 1:210269311-210269333 AAGGCAGAGAAGAAGCAGACAGG + Intergenic
921185370 1:212665513-212665535 GAGGGAGGGAAGAGGGAAGCTGG - Intergenic
922022122 1:221716007-221716029 CAGGGAGAGAAGAGGGAGAGGGG - Intronic
922290415 1:224204972-224204994 CAGGCAGATAAGTGTGTGGCTGG - Intergenic
922334691 1:224609128-224609150 CAGGCAGAGATGAGCAGGGCAGG - Intronic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922753809 1:228083110-228083132 AAGGCAGAGGCGAGGGAAGCAGG - Intronic
922820549 1:228482406-228482428 AGGGTAGAGAGGAGGGAGGCTGG + Intergenic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
923272887 1:232373373-232373395 CAGGCAGAGAGGACAGGGGCAGG + Intergenic
923490748 1:234481902-234481924 GGGGCAGAGAAGGGGGAGTCAGG - Intergenic
923620843 1:235577854-235577876 GAGGAAGGAAAGAGGGAGGCTGG - Intronic
924612188 1:245582914-245582936 CAGGGAGAGAGGAAGGATGCTGG - Intronic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063367704 10:5501029-5501051 CAGGCAGAGCAGTGAGAGGAGGG + Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1064246384 10:13670852-13670874 CTGGCACAGAGGAGGCAGGCAGG - Intronic
1064694847 10:17954811-17954833 CATGCAGAGGCGAGGGAGGGAGG + Intronic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065780463 10:29162058-29162080 CTGGCAGAGAAGGGGGAGGGTGG - Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066309625 10:34183763-34183785 CATACAGAGAAAAGGGAGGGGGG - Intronic
1066330004 10:34411143-34411165 CAGACAGAGATGGGGGAGGAGGG + Intronic
1066400674 10:35072941-35072963 GAGGCAGAGAATGGGGAGGAGGG + Intronic
1067220334 10:44339573-44339595 CAGGAAGAGAGGAGGAAGGCAGG - Intergenic
1067551655 10:47240608-47240630 CAGCCAGAGACCAGAGAGGCAGG + Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068091792 10:52440983-52441005 CAGACAGACAGGAGGGAGTCAGG + Intergenic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1069323853 10:67206565-67206587 AAGGAAGAAAAGAGGGAGGGAGG + Intronic
1069853159 10:71423601-71423623 GAGGCAGAGAAGCTGGTGGCAGG + Intronic
1069908742 10:71747282-71747304 CAGGCAGAAAAGGGAGTGGCAGG + Intronic
1069915600 10:71784862-71784884 CAGTCAGAGAAGGAGGAGGGAGG - Intronic
1069997822 10:72353998-72354020 CAGGGAGGGAAGAGTGAAGCTGG - Intronic
1070626461 10:78054457-78054479 CAGGCGCAGAACAGGGCGGCTGG + Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070850516 10:79558903-79558925 CGTGGAGAGAAGGGGGAGGCTGG - Exonic
1070888805 10:79927125-79927147 CAGCCACAGAGAAGGGAGGCTGG - Intergenic
1071354973 10:84784820-84784842 CAAGGAGAGAACAGGGAGACAGG - Intergenic
1071468473 10:85961814-85961836 AAGGCAGGAAAGAGGGAGGGAGG - Intronic
1071527527 10:86366855-86366877 CGGGCGGAGGGGAGGGAGGCGGG - Intergenic
1071752075 10:88491216-88491238 CAGTCAGAGAAGAGTGAGACTGG - Intronic
1072222342 10:93336985-93337007 CAGGAAGGGAAGAGGGAGTGAGG + Intronic
1072594682 10:96860361-96860383 CAGACACGGAAGATGGAGGCAGG + Intronic
1072620165 10:97074464-97074486 CAGGCTCAGAAGGGGAAGGCAGG + Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1072810675 10:98459100-98459122 GAGGCAGAGAAGAAGGAGTTGGG + Exonic
1072900053 10:99399330-99399352 CAGGCAGAGAAGAGAAGGCCTGG - Intronic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073176439 10:101560284-101560306 CAGGCAGAGGGGCGGGAGGAAGG - Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073452138 10:103616335-103616357 CTGGCAGAGAAGAGAGAAGGTGG + Intronic
1073545470 10:104344858-104344880 CAGGCAGAAAAGAGGCATGGTGG + Intergenic
1073680543 10:105698878-105698900 CAGGGAGGGGAGTGGGAGGCAGG - Intergenic
1074412990 10:113243843-113243865 GAAACAGAGAAGAGGGTGGCTGG + Intergenic
1074787247 10:116851808-116851830 CAAGCAAAGAGGAGGGAGGTAGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075174049 10:120143105-120143127 CCGGCAGAGAATGGGGAGGCTGG + Intergenic
1075376526 10:121982297-121982319 CAGGCAGAGAGGAGAGATGCAGG + Intergenic
1075634340 10:124020048-124020070 CGGGGAGAGAAGATGGAGGCTGG - Intronic
1075730306 10:124631792-124631814 CTGCCAGTGAAGAGGGAGACAGG - Intronic
1075871646 10:125775534-125775556 GAGGCAGAGAAGGGCCAGGCAGG - Intronic
1076183813 10:128431236-128431258 CAGGCAGACAAGGAGGCGGCAGG - Intergenic
1076187523 10:128460893-128460915 CAGGCAGAGCAGAGGTTGGGAGG - Intergenic
1076229538 10:128808606-128808628 CTAGCAGAGAGGAGAGAGGCAGG - Intergenic
1076288193 10:129321990-129322012 GAGGGAGACAAGAAGGAGGCCGG - Intergenic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076413867 10:130271166-130271188 CTGGCAGGGAAGAGTGTGGCAGG + Intergenic
1076423689 10:130352098-130352120 CAGGCAGAGAAAAGGTAGTGGGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076629880 10:131846123-131846145 CAGGCAGCCAAGACGGAGGGAGG - Intergenic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1076888837 10:133274383-133274405 CAGGCAGGGTAGAGGGTGGAGGG + Intronic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077056906 11:598205-598227 CTGGCAGGGGAGAGGAAGGCCGG + Intronic
1077272306 11:1686990-1687012 GAAGGAGGGAAGAGGGAGGCAGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077747816 11:4927109-4927131 CAGACAGAAAAGAGGTGGGCCGG + Intronic
1078084950 11:8228336-8228358 GAGGCTGAGAAGAGGGTGGGGGG + Intronic
1078098516 11:8314949-8314971 AAGGCAGAGAAAAGGGAAGGTGG - Intergenic
1078319729 11:10323406-10323428 CAGCAAGGGATGAGGGAGGCAGG - Intronic
1078452309 11:11449396-11449418 CAGACAGTGAAGAGGGAGAAGGG - Intronic
1078725032 11:13922821-13922843 CCGACAGAGATGGGGGAGGCAGG - Intergenic
1079151266 11:17901601-17901623 CAGGCAGAGATCAGGAAGGGAGG - Intronic
1080233596 11:30044959-30044981 CAGACAGAAAGGAGGGAGCCAGG + Intergenic
1080315041 11:30938313-30938335 CAGACAGACAGGAGGGAGCCAGG - Intronic
1080394001 11:31873428-31873450 GAGGGAGAGAAGAGGGTGGTTGG + Intronic
1080786061 11:35476228-35476250 CAGAGAGAGATGATGGAGGCTGG - Intronic
1081018203 11:37908467-37908489 CAGACAGACAGGAGGGAGCCAGG - Intergenic
1081494896 11:43598553-43598575 CAGGAAGAGAAGAGAGCTGCAGG - Intronic
1081693576 11:45094520-45094542 CAGGAAGAAAAGAGGGAGAGAGG + Intergenic
1082131837 11:48499719-48499741 GAGGCAGGAAAGAGGGAGGTGGG - Intergenic
1082711533 11:56559221-56559243 GAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1082739076 11:56890417-56890439 CAGGCAAAGAAGTGAGAAGCTGG + Intergenic
1083037303 11:59651335-59651357 CAGGCAGGGACTAGGGTGGCAGG - Intronic
1083590996 11:63894818-63894840 CAGGCAGCATGGAGGGAGGCAGG + Intronic
1083596121 11:63918957-63918979 GAGGCGGGGAAGAGGGATGCTGG - Intergenic
1083633227 11:64106321-64106343 GTGGTAGAGAAGAGGGAGGCTGG - Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083996793 11:66276902-66276924 CTGGCAGGGCAGAGGGCGGCAGG - Exonic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084310092 11:68312147-68312169 CAGGGAGAGAAGTGGCCGGCTGG - Intergenic
1084334057 11:68446661-68446683 TTGGCAGAGCAGAGGGAGGCAGG - Intronic
1084346306 11:68551868-68551890 CAGGCAGTGAAGTGGGATGTTGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084364026 11:68686014-68686036 GAGAAAGGGAAGAGGGAGGCAGG - Intronic
1084514769 11:69630836-69630858 CAGGCAGTGGAATGGGAGGCTGG - Intergenic
1084593719 11:70105081-70105103 AGGGCAGAGACGAGGGAGGTCGG - Intronic
1084608674 11:70187055-70187077 CAGGCTGGGAAGAGGGAGATGGG + Intronic
1084749922 11:71197914-71197936 CAGCCAGGGAAGAAGGAGTCGGG + Intronic
1084751105 11:71204919-71204941 CAGATGGAGATGAGGGAGGCAGG + Intronic
1084908673 11:72369575-72369597 AAGGCAGAGGAGAGGCAAGCAGG - Intronic
1084960844 11:72715522-72715544 CAGGCAGAGAACAGGGAGAAGGG - Intronic
1085047430 11:73361943-73361965 CCGGCAGAATGGAGGGAGGCAGG - Intronic
1085052920 11:73388971-73388993 CAGGCAGAGCCCGGGGAGGCCGG - Intronic
1085135919 11:74087973-74087995 CTGGCAGGTAAGATGGAGGCTGG + Intronic
1085297234 11:75438099-75438121 CAGGCAGACAAGGGGAAAGCAGG + Intronic
1085331848 11:75658695-75658717 AAGGGACAGAAGAGGGAGGTAGG - Intronic
1085336688 11:75702045-75702067 CAGGCAGAGAAGAGGACAGATGG - Intergenic
1085482713 11:76836143-76836165 GCGGCAGATAAGAGGGAGGTGGG + Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085806691 11:79643153-79643175 AAGGTAGGGAAGAGGGAGGGAGG + Intergenic
1085806726 11:79643270-79643292 AAGGGAGGGAAGAGGGAGGGAGG + Intergenic
1086212990 11:84343191-84343213 CAGGAAGAGAAGAGAGAGCTGGG + Intronic
1086420236 11:86631286-86631308 TGTGCAGAGAAGGGGGAGGCAGG - Intronic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1087007561 11:93484201-93484223 GAGGCAGAGAGGAGGAAAGCAGG + Intronic
1087379337 11:97384951-97384973 CAGGAAGGAAAAAGGGAGGCAGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088142717 11:106636737-106636759 CAGGCAGAGATGGGGGAACCTGG - Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1088754170 11:112872200-112872222 GAGGCAGAGAAAAGGGAGGTAGG - Intergenic
1088831141 11:113538010-113538032 TAGGCAGATAATACGGAGGCAGG - Intergenic
1089144287 11:116313104-116313126 GCCGCAGAGAGGAGGGAGGCGGG + Intergenic
1089259547 11:117214478-117214500 CAGGCAGAGAAGGCAGAGGAGGG + Intronic
1089362864 11:117902493-117902515 CAGGCAGAGAAGGGGAGGGCTGG + Intronic
1089388389 11:118083040-118083062 GCAGCAGAGGAGAGGGAGGCAGG - Intronic
1089528306 11:119110972-119110994 CTGGCAGAGAAGAGGCAGAACGG + Intronic
1089681634 11:120121951-120121973 CAGGCAGGGAGGAGGCAGGCTGG + Intronic
1089965666 11:122653166-122653188 CAAAGAGAGAAGAGGGGGGCTGG - Intergenic
1090075503 11:123578041-123578063 CTGGCAGAGAGGAGGGTGGCAGG + Intronic
1090227341 11:125079658-125079680 CAGGGAGAGAGAAGGGAGGGTGG - Intronic
1090415908 11:126540421-126540443 CTGGGAGAGAAGTGCGAGGCTGG - Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090561273 11:127935451-127935473 CTGGCAGGCAGGAGGGAGGCTGG - Intergenic
1090710774 11:129382961-129382983 CAGGCAGCTAAAATGGAGGCAGG - Intronic
1090995710 11:131864073-131864095 AAGGAAGAGAAGTGAGAGGCAGG + Intronic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1091350343 11:134889024-134889046 CAGTCAGACAAGAGAGATGCTGG - Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091669793 12:2444854-2444876 CATGCAGAGATCATGGAGGCGGG - Intronic
1091797781 12:3307067-3307089 TGGGCAGAGCTGAGGGAGGCTGG + Intergenic
1091816417 12:3442405-3442427 GAGGCAGAGAAAAGGGGAGCTGG + Intronic
1092013734 12:5139164-5139186 CAGGCAGAGAACAGGGCAGCAGG + Intergenic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092985987 12:13847032-13847054 GAGGCAGAGAAGAGTTAAGCAGG + Intronic
1093274320 12:17105190-17105212 AAAGGAGAGAAGAGGGAGGGAGG - Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094564095 12:31584204-31584226 CAGGGAGAGAGAAAGGAGGCTGG - Intronic
1095385526 12:41645719-41645741 AAGAGAGAGAAGAGGGAGGGAGG + Intergenic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095736438 12:45561661-45561683 AAGGAAGAGAGGAGGGAGGGAGG - Intergenic
1095955865 12:47805559-47805581 CTGGCAGAGAAGATGAAGGCTGG + Intronic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096024926 12:48352102-48352124 GAGGCAGAGAAGAGTCAGGAGGG + Intergenic
1096038112 12:48490770-48490792 CAGTCAGAGATGATGGGGGCTGG - Intronic
1096077223 12:48813498-48813520 CAGGCAGAGAATGTGGAGGGAGG + Intergenic
1096279524 12:50240282-50240304 CAGGCAATGAGGCGGGAGGCAGG + Intronic
1096482430 12:51951626-51951648 CGGGCGGAGGAGAGGGAGGCGGG + Intergenic
1096594734 12:52687640-52687662 CAGGCAGAAAAGGGAAAGGCAGG + Intergenic
1096778222 12:53976538-53976560 CAGGCAGAGGTGAGATAGGCCGG + Exonic
1096861566 12:54532437-54532459 GATGGAGAGAAGTGGGAGGCTGG + Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097005671 12:55915832-55915854 CAGGCAGAGAAAAGGGAAAGGGG + Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097245483 12:57605318-57605340 CTGGCACAGAAAAGGGAGGCGGG - Intronic
1097520195 12:60658175-60658197 CAGTCAGAAAAGAAGCAGGCAGG - Intergenic
1098033442 12:66278365-66278387 CAGGTGGGGAAGAGAGAGGCAGG + Intergenic
1098058256 12:66532500-66532522 GAGACAGGGAATAGGGAGGCAGG - Intronic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1099018201 12:77370946-77370968 CAGACAGAGAACAGGGTGGGTGG + Intergenic
1099718629 12:86331710-86331732 CAGGCAGACATGAGCAAGGCAGG - Intronic
1099831730 12:87852250-87852272 GGGATAGAGAAGAGGGAGGCAGG + Intergenic
1099918156 12:88922126-88922148 CAGGGATGGAAGAGGGAAGCAGG + Intergenic
1100009628 12:89937829-89937851 CAGAGAGAGAGGAGGAAGGCAGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100391372 12:94148629-94148651 CGGGCGGAGAGGAGCGAGGCGGG - Intergenic
1100748062 12:97667307-97667329 AAGGGAGGGAAGAGGGAGGGAGG + Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101821229 12:108185718-108185740 ATGGCAGAGAACAGGGAGGAAGG - Intronic
1102013495 12:109633066-109633088 CAGGCAGGCAGGAGGGAGGGAGG + Intergenic
1102039839 12:109793875-109793897 CAGGAAGAGAAGAGGAGGGCAGG + Intronic
1102523952 12:113497606-113497628 GTGCCAGAGAAGGGGGAGGCCGG + Intergenic
1102854071 12:116277858-116277880 CCGGCCGGGAAGAGGGAGGGAGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103117167 12:118345433-118345455 CAGGAATAGAAGAGGAAGGAAGG + Intronic
1103520331 12:121533643-121533665 CAGCCAGAGAAGATGAATGCTGG + Intronic
1103915099 12:124372133-124372155 AAGGCAGAGAAGAAGGAGGGCGG - Exonic
1103931574 12:124453513-124453535 CAGGCAGAGATGAGGCATGGTGG + Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104092136 12:125526143-125526165 GAGGCCCAGAGGAGGGAGGCTGG - Intronic
1104161059 12:126181540-126181562 AGGGCAGAGATGAGGGATGCAGG - Intergenic
1104437487 12:128767381-128767403 CAGGCAGGGGGGAGGGAGGGAGG + Intergenic
1104463379 12:128971867-128971889 AAGGGAGAGAGGAGGGAGGGAGG - Intronic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104895572 12:132162105-132162127 CAGGCTGAGAAAACCGAGGCAGG - Intergenic
1104926933 12:132318720-132318742 CAGGCAGACGAGAGGAGGGCAGG - Intronic
1104932472 12:132347111-132347133 CAGACACAGAAGAGCCAGGCAGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1106009168 13:25801471-25801493 CAGACAGGGATGTGGGAGGCAGG - Intronic
1106038058 13:26063318-26063340 CAGGCAGAGAAGAAAGAGGTGGG + Intergenic
1106096831 13:26653676-26653698 CAGGCAGAGAAGAGCCAAGTGGG - Intronic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1107173719 13:37376213-37376235 CAGGCAGAGAAGAAGGCACCAGG - Intergenic
1107315423 13:39126424-39126446 CAGGGAGAAGAGAGGTAGGCAGG + Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107569176 13:41638477-41638499 GAAGCAGACAAGAGGGAAGCTGG + Intronic
1107788507 13:43977836-43977858 AAGGAAGAAAAGAGGGAGGGAGG - Intergenic
1107901083 13:45014713-45014735 CAGGAAGAGAGGTGGGAGGTGGG + Intronic
1108042928 13:46356208-46356230 CAGGGAGAGAACTAGGAGGCTGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108795392 13:54024029-54024051 CAGTCACAGTAGAGGGTGGCTGG - Intergenic
1108842614 13:54638781-54638803 CAGGCAGAAGAGAGTGAAGCAGG + Intergenic
1109061711 13:57629982-57630004 GAGGCGGAGAAGAGGATGGCGGG - Intergenic
1109671314 13:65612208-65612230 CAGGCAGAAGGGAGGGAGGGAGG + Intergenic
1112261768 13:97884049-97884071 CAAGCAGGGGAGAGGGAGACGGG + Intergenic
1112785592 13:102947883-102947905 CAGGCAGGGAAGTAGGAGGATGG + Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113184644 13:107674185-107674207 CTAGCAGAGAACATGGAGGCAGG - Intronic
1113373897 13:109746151-109746173 AAGGCAGGGCACAGGGAGGCTGG - Intergenic
1113412734 13:110104816-110104838 CAGGCAGAGAAGCCTGAGGTGGG - Intergenic
1113558379 13:111256735-111256757 CAGGCACAGAAGAGGTAGCTCGG - Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113670028 13:112170343-112170365 GAGGCCGAGAAGATGGAGGTGGG + Intergenic
1113889179 13:113727005-113727027 CAGGCAGAGAGGCCGCAGGCTGG - Intronic
1113897330 13:113774121-113774143 TAGGAAGAGAAGAAGCAGGCGGG - Intronic
1114267281 14:21080436-21080458 AAGGCAGATGAGAGGGAAGCTGG - Intronic
1114290671 14:21285868-21285890 CAGGCAGAAATAAGGGAGGATGG + Intergenic
1114406219 14:22458812-22458834 GAGCAAGAGAAGAGGGTGGCAGG - Intergenic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1115199766 14:30840485-30840507 CAGACAGACAGGAGGGAGACAGG + Intergenic
1115307102 14:31944592-31944614 CAGGCAGAGGTGGGTGAGGCTGG - Intergenic
1115707357 14:36012897-36012919 CAGACAGACAGGAGGGAGCCAGG - Intergenic
1115762813 14:36592210-36592232 CTGGCACAGATGAGGGATGCAGG - Intergenic
1116494078 14:45539406-45539428 TAGGAAGAGTAGAGGGAGGCAGG - Intergenic
1116593577 14:46810995-46811017 CAAGAAGAGAAGAGGGAGAGGGG + Intergenic
1116868367 14:50049514-50049536 GAGGCCAGGAAGAGGGAGGCTGG - Intergenic
1116953465 14:50899523-50899545 TAGGCACAGAATAGGGAGGTTGG - Intronic
1117442899 14:55776869-55776891 CAGTAAGAGAAGATGCAGGCCGG + Intergenic
1117464819 14:55982620-55982642 CAGGCAGAGAAGTGAGTGGCAGG - Intergenic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118775765 14:68973127-68973149 GAGGCAGAGAAGGGGGAGCCTGG + Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118982408 14:70727475-70727497 AAGGCAGAGGAAAGGGGGGCCGG + Intronic
1119085142 14:71732473-71732495 CAGGCAGATAACAGGAAGGGCGG - Intronic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1119162110 14:72461250-72461272 CAGGCAGTGGAGAGGGTGGGAGG + Intronic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119263326 14:73250881-73250903 TGGGCAGAGATGCGGGAGGCAGG - Intronic
1119546365 14:75474819-75474841 AAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1119589088 14:75868185-75868207 GAGGCAGAGAAGAGAGTGGGAGG - Intronic
1119625807 14:76174369-76174391 CAGTCAGAGAAGATGGTGGTGGG + Intronic
1119650983 14:76382540-76382562 CAGGGAGAGAAGGGGAAGTCGGG - Intronic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120185150 14:81386433-81386455 CAGCCATTTAAGAGGGAGGCAGG - Intronic
1120613369 14:86670987-86671009 GGGGCAGTGAAGAGGGAGGTGGG - Intergenic
1120685137 14:87529222-87529244 CTTGCAGACAAGAGGGAGCCTGG - Intergenic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121096404 14:91220760-91220782 CAGGCAATGACGAGGCAGGCGGG - Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121560580 14:94872396-94872418 GGTGCAGAGAAGAGGGAGCCAGG - Intergenic
1121766782 14:96494708-96494730 CAGGTAGAGGGGAGGGAGGAGGG - Intergenic
1121853832 14:97248255-97248277 CAGGCAGAGACAAAGGTGGCCGG + Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1121916037 14:97837646-97837668 CAGACAGGGAACAGGGAGGCAGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122080380 14:99263007-99263029 AATGGAGATAAGAGGGAGGCTGG + Intronic
1122123209 14:99565591-99565613 CATGCAGCCAGGAGGGAGGCTGG + Intronic
1122215572 14:100201545-100201567 CAGGGAGAGGAGAGGGAGATAGG + Intergenic
1122623010 14:103070487-103070509 GAGCCAGTGATGAGGGAGGCAGG + Intergenic
1122717487 14:103704254-103704276 CAGGTAGGGAAAGGGGAGGCAGG + Intronic
1122905402 14:104799421-104799443 AAGGCAGAGAAGAATGAGACCGG + Intergenic
1122943337 14:104993328-104993350 CAGGGAGAGAAGAGAGCTGCAGG + Intronic
1123043992 14:105502669-105502691 CAGGCAGGGCAGCGAGAGGCCGG - Intergenic
1123946528 15:25241501-25241523 CACGCGGAGAAGGGGGTGGCTGG - Intergenic
1124064326 15:26325791-26325813 AAGGCATAGAAAGGGGAGGCAGG + Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124590839 15:31051570-31051592 CAGACAGGGAAGAGGAAAGCTGG - Intronic
1124615550 15:31239186-31239208 AAGACAGGGAAGTGGGAGGCAGG + Intergenic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1125029756 15:35064316-35064338 AGGGGAGAGAAGAGGGCGGCAGG - Intergenic
1125073185 15:35580727-35580749 AAAGGAGTGAAGAGGGAGGCGGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1125662795 15:41407480-41407502 CAGACAGATGAGAGGGAGACGGG + Intergenic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127397706 15:58555881-58555903 AGGGCGGAGAAGAGAGAGGCAGG - Intronic
1127618539 15:60710808-60710830 AGGGCACAGAAGAGGGAGGGAGG + Intronic
1127704165 15:61530888-61530910 CAGGCAGAGTTGAGGGGGGGGGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1128072556 15:64806826-64806848 GAGGCAGAAGAGAGGAAGGCAGG + Intergenic
1128211093 15:65903036-65903058 CAGGAAGAGAAGAGGCAGTGTGG - Intronic
1128226614 15:66006176-66006198 AAGGAAGAGGAGAGGCAGGCTGG + Intronic
1128229617 15:66025385-66025407 GAGGCAGGGAGGAGGGAGGAGGG + Intronic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128407179 15:67354623-67354645 AAGGAAGAGAAGAGGGAAGGAGG + Intronic
1128440331 15:67701579-67701601 TAAGCAGAGAAGAGGAAGGCAGG + Intronic
1128506376 15:68275922-68275944 TTGGCAGAGGAGAGGGAGGGTGG + Intergenic
1128563671 15:68684923-68684945 CAGTCATAGAAGAGAGAGCCAGG + Intronic
1128647495 15:69388128-69388150 CAGGGAGGGAGGAGGGAGGCAGG - Intronic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1128730118 15:70015203-70015225 CAGGAAGAGAGGCTGGAGGCAGG + Intergenic
1128819756 15:70641177-70641199 CAGGCAGAGAAGGGTGAAGATGG + Intergenic
1129300198 15:74621046-74621068 GAGGCAGGGAAGAGGGATGGGGG - Intronic
1129301882 15:74630231-74630253 CAGGCACAGAAGAGCTAGGCAGG + Intronic
1129426458 15:75467040-75467062 CTGGGAGGGATGAGGGAGGCAGG - Exonic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130509725 15:84579395-84579417 CAGGCAGATGGGAGGGAGCCAGG - Intergenic
1130520912 15:84659956-84659978 GATGCAGAGGAGAGGGAGGGGGG - Intergenic
1130585444 15:85177360-85177382 CAGGCAGATGGGAGGGAGCCAGG + Intergenic
1130650133 15:85757802-85757824 CTCCCAGAGAAGCGGGAGGCAGG + Intergenic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131529522 15:93179838-93179860 CAGACAGGGAAGAGGGAGAAAGG + Intergenic
1131669789 15:94607618-94607640 CAGGATGAGAGGAGGGCGGCGGG - Intergenic
1132086224 15:98910510-98910532 CAGGCAGATAAGAGGGCGAAAGG + Intronic
1132250616 15:100333096-100333118 CAGGGAGAGAGAAGGAAGGCTGG - Intronic
1132396453 15:101478513-101478535 AAGCCACAGAAGAGGGAGGGAGG - Intronic
1132436467 15:101808409-101808431 CAGGCAGAGAGGAGGCAAACAGG + Intronic
1132676771 16:1124294-1124316 AGGGGAGAGAAGAGGGAGGCTGG + Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132816801 16:1832915-1832937 CAGCCACAGAGGAGGGATGCAGG - Intronic
1133099568 16:3470871-3470893 GGGGCAGAGAAGAGGCAGGAAGG - Intronic
1133320205 16:4909060-4909082 CAGGCAGAGGCCAGGGAGGCAGG + Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1133584683 16:7181510-7181532 AAGGGAGGGAAGAGGGAGGGAGG - Intronic
1133606301 16:7391396-7391418 AACGAAGAGCAGAGGGAGGCAGG - Intronic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135184900 16:20307136-20307158 CAGGCAGGGATGAAGGTGGCAGG - Intergenic
1135202642 16:20451878-20451900 CAGGGAGAGACGAGGGCAGCTGG + Intronic
1135216461 16:20575988-20576010 CAGGGAGAGACGAGGGCAGCTGG - Intronic
1135377779 16:21964290-21964312 CAGGCAGAATAGATGCAGGCTGG - Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135866816 16:26110848-26110870 CACGCAGACAAGAAGGAGGCCGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135967677 16:27049391-27049413 CAGGCTGAGAAGCTGGAGTCAGG - Intergenic
1136111704 16:28067587-28067609 GAGCCAGAGAGGAGGGAGCCAGG - Intergenic
1136500438 16:30667413-30667435 GTCGCAGTGAAGAGGGAGGCCGG - Exonic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1137603104 16:49769798-49769820 CAGGCAGAGGAGGGAGAGGTGGG - Intronic
1137693419 16:50445714-50445736 CAGGCACAGAGGGGGAAGGCTGG + Intergenic
1137773965 16:51040676-51040698 CAGGCAGGGAGGAGGGAGGCAGG + Intergenic
1137812933 16:51370364-51370386 CAGGCAGAGGAGAGGAGGCCAGG - Intergenic
1138416713 16:56875855-56875877 CAAGCAGAGAAGAGGTGAGCTGG - Intronic
1139319620 16:66103341-66103363 CAGGTAGAGAAGGGGAAGCCAGG + Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139341320 16:66269949-66269971 GAGGGAGAGAAGAGGAAGGGAGG + Intergenic
1139345311 16:66299377-66299399 CAGGCAGAAAACAGGGAAGAAGG - Intergenic
1139685048 16:68596947-68596969 AAGGCAGAGAAAAGGAAGGTGGG - Intergenic
1139725208 16:68891951-68891973 AAGGCAGGGAGGAGGGAGGGAGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140436559 16:74951611-74951633 AAGGCAGTGAAGAGGAAGCCAGG + Intronic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1140712867 16:77694637-77694659 AAGGCAGTGATGAGGGAGGGGGG - Intergenic
1140753897 16:78049902-78049924 GAGGCAGAGTGGAGGTAGGCAGG + Intronic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141146023 16:81530641-81530663 AAGGGAGAGATGTGGGAGGCGGG - Intronic
1141342181 16:83213361-83213383 CAGGCAGAGAAACGGGAGGGTGG + Intronic
1141377088 16:83541387-83541409 CAGGCAAAGAAGAGAGGAGCTGG - Intronic
1141505674 16:84476656-84476678 CATAAAGACAAGAGGGAGGCAGG + Exonic
1141558070 16:84849168-84849190 CGGGCAGCGAGGAGGGAGGGAGG - Intronic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1141651829 16:85396947-85396969 CAGGCAGAGAACAGAGTGACAGG + Intergenic
1141689684 16:85589106-85589128 TGGGCAGAGAGGAGGGAGGGAGG - Intergenic
1141786092 16:86201816-86201838 CAGGCAGAGCTGAGTGAGGCGGG + Intergenic
1141949832 16:87333331-87333353 CCGGCACAGCAGAGGCAGGCAGG + Intronic
1141968567 16:87464142-87464164 CAGGCTGAGAGTTGGGAGGCTGG - Intronic
1142251371 16:88993566-88993588 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142741611 17:1934905-1934927 CAGGCAGAGGCTCGGGAGGCCGG - Exonic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142958168 17:3535220-3535242 GAGGGAGGGAGGAGGGAGGCAGG - Intronic
1143163610 17:4886668-4886690 CTGGCAGAGAGGAGCCAGGCTGG - Intronic
1143164541 17:4891430-4891452 CAGGGAGAGACCAGGGAGGGTGG - Intronic
1143233722 17:5379864-5379886 GAGGCAGAGAGGTGTGAGGCAGG - Intronic
1143591434 17:7887750-7887772 GAGGCAGGGAGGAGAGAGGCGGG - Intronic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1143739335 17:8941213-8941235 GAGGCAGAGAGTAGGGAGGCAGG + Intronic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144203350 17:12961101-12961123 CTGGCAGAGAGGATGGAGGAGGG - Intronic
1144837798 17:18166339-18166361 CCTGCAGAGAGCAGGGAGGCAGG - Exonic
1144889938 17:18488837-18488859 GAGGCAGAGAACAGGCAGGCAGG - Intronic
1145142278 17:20455480-20455502 GAGGCAGAGAACAGGCAGGCAGG + Intronic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1145860561 17:28206569-28206591 GAGGCAGAGAAGACAGAGACTGG - Intergenic
1145861754 17:28217015-28217037 AAGGCAGAGAAGACAGAGACTGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146489443 17:33269675-33269697 CAGGCAGGCAGGAGGGAGGGAGG - Intronic
1146677318 17:34782348-34782370 CAGGCAGAGACCAGAGAGGCTGG + Intergenic
1146793402 17:35765428-35765450 GAGGCAGAAGACAGGGAGGCTGG + Intronic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1146990770 17:37269993-37270015 CAGAAAGAGAAAAGGGAGACAGG - Intronic
1147015389 17:37488233-37488255 GAGTCAGTGAAGAGGGAGGTGGG - Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1147341801 17:39756711-39756733 CAGGCAGAAGAGAGGGAGACAGG - Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147637431 17:41972613-41972635 TAGGCAGAGAAGTGGGAGAGTGG - Intronic
1147906958 17:43829801-43829823 AAGCCAGAGAAAAGGAAGGCTGG + Intronic
1147952141 17:44113152-44113174 CAGGCATAGGAGAGTGTGGCAGG + Intronic
1148116142 17:45176170-45176192 CAGGCAGTGAAGGTGGAGCCAGG + Intergenic
1148465835 17:47864830-47864852 CAGGTAGAGAGGAGGAGGGCGGG - Intergenic
1148859580 17:50596977-50596999 GAGGAAGAGAGGATGGAGGCAGG + Intronic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1150859444 17:68786319-68786341 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1151157002 17:72132050-72132072 AATGCAGAGGAGAGGGAGGAGGG + Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151267489 17:72967995-72968017 GAGGTGGAGAAGAAGGAGGCTGG - Intronic
1151354259 17:73549182-73549204 CAGGCAGAGAAGCCGGAGTGAGG + Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151659344 17:75510341-75510363 CAGAGAGAGAACAGGGAGGTGGG - Intronic
1151726456 17:75887723-75887745 TAGGAAGAAAAGAGGGGGGCCGG + Intronic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152224830 17:79087869-79087891 CAGGCAAGGAAGATGGAGACAGG - Intronic
1152238599 17:79150729-79150751 TAGCCAGAGAAGAGGCAGGTAGG + Intronic
1152271004 17:79324841-79324863 CAGGCAGAGAAGCAGGAAGAGGG + Intronic
1152390403 17:80000890-80000912 TAGGCAGAGAAGGGGCTGGCGGG - Intronic
1152428016 17:80229140-80229162 CAGCCACAGAAGAGAGAGGGTGG + Intronic
1152509590 17:80776940-80776962 CAGGAAGTGAAGGGGGAGGCCGG + Intronic
1152868508 17:82738049-82738071 CAGGCAGGGAAGAAGAGGGCTGG - Intronic
1153161420 18:2208506-2208528 CAGGCAGGGAAAAAGGAAGCAGG - Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1154179933 18:12127261-12127283 CAGGGAGAGAAGTGGAAGCCAGG + Intronic
1154256132 18:12782250-12782272 CAAGCTGAGAACAGGGAAGCTGG - Intergenic
1155021656 18:21902247-21902269 CCGGCAGAGGAAAGGAAGGCTGG - Intergenic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1155075702 18:22352219-22352241 CAGGCAAAGAAGAGTGAAGGAGG - Intergenic
1155101296 18:22612965-22612987 CAAGCAGAGAAGAGCGATGAAGG + Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156105682 18:33657333-33657355 GAGGCTGAGAATTGGGAGGCTGG + Intronic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1156590007 18:38476103-38476125 GAGGTAGAGAAGATGGAGGTAGG + Intergenic
1156894926 18:42235149-42235171 AAGGCAGAGGAGAGGCTGGCTGG - Intergenic
1157049970 18:44152038-44152060 CAGGAAGAGAATAGGGAAGGTGG + Intergenic
1157112279 18:44832647-44832669 CAGGAAGAGATGAGGAAGGCTGG - Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157579038 18:48762884-48762906 CATGCAGAGGAGAGGGTGGGTGG - Intronic
1157709647 18:49841386-49841408 CAGACAGTGAAGAAGGCGGCAGG + Exonic
1157980251 18:52371634-52371656 CACCCAGAGAAGAAGCAGGCGGG - Intronic
1158027315 18:52915733-52915755 GAGGCAGAAAAGAGGAAGGAAGG + Intronic
1158536805 18:58315693-58315715 CAGTCAGGGAAGAGACAGGCAGG - Intronic
1158848172 18:61466863-61466885 GGGACAGAGAAGAGGGAGGCGGG - Intronic
1159546504 18:69845569-69845591 CATGGAGAGAATAGAGAGGCAGG + Exonic
1159798609 18:72869776-72869798 CGGGGAGAGAAAAGAGAGGCAGG + Intergenic
1160077862 18:75694799-75694821 CAGGCAGAGAGCAGGCAGGAAGG - Intergenic
1160378862 18:78433852-78433874 CTGCCAGTGACGAGGGAGGCTGG + Intergenic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161238213 19:3208312-3208334 CAGTCGGAGAAGGGGAAGGCTGG - Exonic
1161339905 19:3735703-3735725 CAGGCAGAGCTGGGGGAGGTTGG + Intronic
1161390195 19:4016700-4016722 CAGGCAGAGAGGAGGGGGCAGGG + Intronic
1161458416 19:4381594-4381616 GAGGCAGGGGAGACGGAGGCAGG - Intronic
1161460563 19:4394393-4394415 CAGGCAGAAAGGAGGGAACCAGG + Intronic
1161591603 19:5131562-5131584 GAGGCAGGGAGGAGGGGGGCAGG + Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161975679 19:7606743-7606765 GAGGCAGAGAGGAGGGCAGCGGG - Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162040987 19:7971032-7971054 GAGGCAGAGAGAAGGGAGCCAGG - Intronic
1162091628 19:8284048-8284070 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162093865 19:8298896-8298918 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162375849 19:10304973-10304995 ATGGCAGAGAGGAGGCAGGCCGG + Exonic
1162413825 19:10521956-10521978 CAGCCAGAGAACAGAGAGGCAGG + Intergenic
1162475085 19:10895043-10895065 CAGATAGAGAATAAGGAGGCCGG - Intronic
1162484776 19:10952886-10952908 CAGTCTGAGAAGAGTGAGTCTGG - Intergenic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1162967706 19:14163868-14163890 GTGGCAGAGAAGAGGGAGAAGGG - Intronic
1162984639 19:14261746-14261768 GAGAAAGACAAGAGGGAGGCTGG - Intergenic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1163175793 19:15563501-15563523 CAGGCAGGGAGGAGGCAGCCAGG + Intergenic
1163204906 19:15795216-15795238 TAGGCAGAGAAGAAGGAAGGGGG - Intergenic
1163325920 19:16603194-16603216 CAGCCAAAGAAGAGAGGGGCTGG + Intronic
1163499029 19:17664613-17664635 CAGGCAGAGTGGAGGCAGGAAGG - Intronic
1163545993 19:17941873-17941895 CAGGCAGTGAGGGGGCAGGCAGG + Intronic
1163548122 19:17951195-17951217 CAGGCAGGGGACAGGGAGGGGGG - Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164645435 19:29855706-29855728 CAGGCAGAGGGGAGGGAGTGGGG - Intergenic
1164845512 19:31429323-31429345 AAGGGAGTGAAGAGGGTGGCAGG + Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165755076 19:38288273-38288295 CAGGCAGACAGGAGGGTGGGTGG - Intronic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1166015279 19:39974698-39974720 AAGGAAGAGAAGTGGGAGTCAGG - Intronic
1166040498 19:40199581-40199603 CAGGCAAGGAAGAGAGAGGTAGG + Intronic
1166193894 19:41193874-41193896 GAGGCAGAGAAGAGGCTGGAGGG + Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166329582 19:42070219-42070241 GAGAGAGAGAAGAGGGAGGGAGG + Intronic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166651226 19:44576647-44576669 AAGAGAGAGAAGAGGAAGGCCGG + Intergenic
1166677211 19:44747588-44747610 GAGGGAGGGAGGAGGGAGGCGGG - Intergenic
1166874578 19:45889935-45889957 CAGGCAGGCAATTGGGAGGCTGG - Intergenic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167103210 19:47416703-47416725 CTGGGAGGGAAGAGAGAGGCCGG + Intronic
1167189486 19:47974564-47974586 CGGGTAGAAAAGAGAGAGGCCGG - Intronic
1167501153 19:49849336-49849358 CAGGTAGAGAACAGGAAGGATGG + Intergenic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167641493 19:50685096-50685118 TGGGCAGAGAAGAAGGAAGCGGG + Intronic
1167744554 19:51342874-51342896 CAGGAAGAGAAGACAGAGCCTGG - Intergenic
1168010559 19:53527740-53527762 CATGTGGAGAAGAGAGAGGCAGG + Intronic
1168072090 19:53959040-53959062 CATCCAGAGAGGAGGGAGGAGGG - Intergenic
1168076911 19:53985519-53985541 CGTGGAGAGAAGAGGGATGCCGG + Exonic
1168417023 19:56175692-56175714 GACGCAGATAAGAGGGAGGGAGG + Intergenic
1168487042 19:56772311-56772333 TTGGCAGAGAAGAGAGAGGGTGG - Intergenic
1168558480 19:57363650-57363672 CAGCCAGGGAAGAGAGGGGCGGG - Exonic
1168561708 19:57390057-57390079 CAGCCAGGGAAGAGCGGGGCGGG - Exonic
1168564384 19:57411349-57411371 CAGCCAGGGAAGAGCGGGGCGGG - Exonic
925036447 2:690352-690374 CTGGCAGAGAAGGGCGAGGCTGG - Intergenic
925223946 2:2166168-2166190 AAGGAAGAAAACAGGGAGGCAGG - Intronic
925253894 2:2465774-2465796 TAGGCAGAGAAGAGGGAGACAGG - Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925410130 2:3635085-3635107 CAGGCAGGGGAGAGGGGGACAGG - Intronic
925411274 2:3641187-3641209 CAGGGAGAAAAGAGAGGGGCTGG + Intronic
925640609 2:5982885-5982907 AAGGAACAGAAGACGGAGGCAGG - Intergenic
925905631 2:8538256-8538278 CAGGGAGAGAGGAGAGAGGGTGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926692675 2:15748137-15748159 CAGGCAGGGAAGAATGAGGTGGG + Intergenic
927275858 2:21261829-21261851 CAGGCAGAGAATGTGCAGGCAGG + Intergenic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928096300 2:28407147-28407169 GAGGCAGAAAAGAAGGAGGCTGG - Intronic
928355979 2:30614920-30614942 CAGGAAGCCAAGAGGGAGGGAGG + Intronic
928920280 2:36519896-36519918 ATGGCAGAGAAGAGCGAGGGAGG + Intronic
929061697 2:37930934-37930956 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
929089349 2:38199396-38199418 GAGGCAGAGAAGAGGGAAAATGG + Intergenic
929171143 2:38934515-38934537 GAGGGAGAGAAGGGGGAGGGAGG - Intronic
929171159 2:38934553-38934575 GAGGGAGAGAAGCGGGAGGAAGG - Intronic
929258512 2:39839394-39839416 CAGGAAGAGAATAGGGAGGCTGG - Intergenic
930036760 2:47090616-47090638 CTGGCAGGGAGAAGGGAGGCAGG - Intronic
930049740 2:47205759-47205781 AAGGCGGAGAGGAGGGAGGCTGG + Intergenic
930652124 2:53973025-53973047 CAGACAGAGAAAAGGAAGGTAGG + Intronic
930873976 2:56193187-56193209 CAGGCACAGTGGAGGGAGCCCGG + Exonic
930886518 2:56332691-56332713 CAGGGAGAGAAGAGGGAGAGAGG - Intronic
930934936 2:56937497-56937519 AAGGCAGAGAAGGAGCAGGCAGG + Intergenic
931219835 2:60278993-60279015 GAGCCAGAGTAGAGGGAGGTAGG - Intergenic
931276297 2:60746573-60746595 CAGACAGACAGGAGGGAGCCAGG - Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932251489 2:70248374-70248396 GGGGCAGCGATGAGGGAGGCGGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932334551 2:70922627-70922649 GAGGCAGAGGAGGGGCAGGCCGG + Intronic
932376622 2:71241746-71241768 CAGGCAGAGACATGGGAGCCAGG + Intergenic
932465649 2:71922472-71922494 CAGGGAGAGAAAAGGGGGTCTGG - Intergenic
932771372 2:74502551-74502573 CAGGCGGAGGAGCGTGAGGCGGG + Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933747936 2:85584446-85584468 CAGGCAGAGAAGCCGGGAGCGGG + Exonic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934067289 2:88351430-88351452 CCGACAGAGAAGAGAGAGGGCGG - Intergenic
934116943 2:88807616-88807638 CTGGGACAGATGAGGGAGGCAGG - Intergenic
934516869 2:94993835-94993857 CAAGTAGAGCTGAGGGAGGCTGG + Intergenic
934562085 2:95318594-95318616 CAGGCAGAGGAGGGAGAGCCTGG - Intronic
934566530 2:95344609-95344631 GAGGCAGAGAAGAGGGTTGGAGG + Intronic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934774958 2:96931517-96931539 GAGACAGAAAAGACGGAGGCAGG + Intronic
934791016 2:97060143-97060165 CAGACAGGGAGGATGGAGGCTGG - Intergenic
934818918 2:97355073-97355095 CAGACAGGGAGGATGGAGGCTGG - Intergenic
935210876 2:100938586-100938608 TATGCAGAGAGGAGGGAGGGAGG - Intronic
935654067 2:105406851-105406873 CAGGCAGAAGAGAGTGAGGAAGG - Intronic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935856978 2:107285453-107285475 CAGGCAGAGAAAAGGCAAGAAGG - Intergenic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936089028 2:109489089-109489111 CAGGCAGTGGAGTTGGAGGCTGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936141990 2:109948462-109948484 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936178677 2:110246410-110246432 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936202701 2:110423022-110423044 AAGACAGTGGAGAGGGAGGCAGG - Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936547675 2:113406600-113406622 CAGACAGGGAAGATGGAGACTGG - Intergenic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
936984212 2:118292674-118292696 GAGGCAAAGAGGAGGGAGGGTGG - Intergenic
937262984 2:120598216-120598238 GAAGCAGTGCAGAGGGAGGCAGG - Intergenic
937381587 2:121382263-121382285 TAGGCTGAGAAAAGGGAGGTGGG + Exonic
937642342 2:124228034-124228056 AAGCTGGAGAAGAGGGAGGCTGG + Intronic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
937872187 2:126793830-126793852 GAGGAAGAGAAGAGGGAGAAAGG + Intergenic
937912419 2:127082001-127082023 CAGACAGAGGACAGGCAGGCGGG + Intronic
937984521 2:127632551-127632573 CTGCCAGAGAAGAGGGTGGAGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938464848 2:131518785-131518807 CTGGCAGGAAGGAGGGAGGCTGG + Intergenic
938807976 2:134824507-134824529 CAGGCAGAGATGGGGGAGTTTGG + Intergenic
938821475 2:134964421-134964443 AAAGCAGAGCAGAGGAAGGCAGG - Intergenic
938969558 2:136419836-136419858 CAGGCAGGGAGAAGGGAGACGGG - Intergenic
939178658 2:138780402-138780424 CGGGCAGGGAAGGGGGAGGGTGG + Intergenic
939403791 2:141730212-141730234 GAGACGGAGAAGAGGGAGTCTGG + Intronic
939513844 2:143141543-143141565 GAGGCAGAGAAAAGAGAGGGAGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940174104 2:150859913-150859935 GAGGGAGAGAAGAGGAAGCCTGG + Intergenic
940215759 2:151301805-151301827 CAGGCTGAGAAGAGTGTGGCAGG + Intergenic
940263274 2:151807969-151807991 CAGGTAGAGAGGAGTGGGGCAGG - Intronic
941170034 2:162125269-162125291 CAGACAGGGAGGAGGGAGGGGGG - Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
942447121 2:176085512-176085534 CAGGCGGAGGCGAGGGAGGACGG + Intergenic
942716445 2:178897971-178897993 TAGGGAGAGATGAGGAAGGCTGG + Intronic
943715965 2:191152132-191152154 CCGTCAGGGAAGAGGGAGGCAGG - Intergenic
944318236 2:198306561-198306583 CAAGTGGAGAAGAGGGTGGCGGG - Intronic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
944659065 2:201905317-201905339 CAGGCAGAGAGGATGGAAGAGGG - Intergenic
945126068 2:206511455-206511477 CAGGGAGGGAAGAGTGAGCCAGG + Intronic
945624689 2:212188255-212188277 GAGGGAGAGAAGAGGGAGGGAGG - Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
945976671 2:216276514-216276536 CAGCCAGAGACCAGGGATGCTGG - Intronic
946320796 2:218953359-218953381 CAGCCACAGAAGGGGCAGGCTGG + Intergenic
946336201 2:219038334-219038356 CAGGCAGAGCAGGGTGTGGCAGG - Intronic
946441936 2:219704156-219704178 CTGGCGGAGGAGAGGGAGACAGG + Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947179423 2:227399021-227399043 GAGGGAGGGAAGAAGGAGGCAGG + Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947821571 2:233075076-233075098 GAGGCAAAGAAGAGGCAGGAAGG - Intronic
947993966 2:234511635-234511657 CCAGCAGAGAAGTGGGAGGCTGG + Intergenic
948012625 2:234662099-234662121 CAGGCAGAGAAGGGGGTGAGGGG - Intergenic
948025781 2:234775092-234775114 GAGGAAGAGAAGGGGGAGGAGGG + Intergenic
948529442 2:238595039-238595061 CAGTCAGAAAAGAGGGAGACTGG - Intergenic
948637556 2:239349168-239349190 CAGGCAGGCAAGAGTGAGCCGGG + Intronic
948657954 2:239488291-239488313 GAGGCAGAGAAGCGGCTGGCTGG + Intergenic
948661307 2:239508181-239508203 CTCGCAGAGAGAAGGGAGGCTGG - Intergenic
948767393 2:240230304-240230326 CAGCCAGAGAACAGCGAGGCTGG + Intergenic
948838298 2:240636793-240636815 CAGGAACAGAAGGGGGAGGGTGG - Intergenic
948883487 2:240871810-240871832 CATGCGGGGATGAGGGAGGCTGG - Intronic
948931130 2:241133176-241133198 GAGGCAGAGAAGAGGGCGCTGGG - Intronic
949001204 2:241615156-241615178 CAGGCAGAAAGGATGGAGGGTGG + Intronic
1168744104 20:221445-221467 GAGGGAGAGAGGAGGGAGGGAGG + Intergenic
1168814141 20:725179-725201 CAGACAGAAGAGAGAGAGGCTGG - Intergenic
1168855436 20:1004393-1004415 GAGGCAGTGAAGAAGGAGGTAGG - Intergenic
1168871966 20:1137075-1137097 CAGGCAGAGACCAGAGATGCTGG - Intronic
1169276505 20:4236729-4236751 CAGACAGGAAGGAGGGAGGCAGG + Intronic
1169326295 20:4679381-4679403 CAGGCAGAGAAGAGAGAGGCAGG + Intergenic
1169506463 20:6216541-6216563 GAGGAAGAGAAGAGGGAGGCAGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1169884505 20:10383488-10383510 CAGGCAAAGATGTGGGAGACAGG + Intergenic
1169971706 20:11275699-11275721 AGGGAAGAGAAGAGGGAGGGAGG - Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1171160636 20:22919588-22919610 TAGGCAGAGAACAGGAAGGTGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172740675 20:37164221-37164243 GAGGGAGAGAGGAGGGAGGCAGG - Intronic
1172785970 20:37469244-37469266 CAGGCAGGAAGGAGAGAGGCAGG - Intergenic
1173128364 20:40362167-40362189 CAGGAAGAGAACAGAGAGGATGG + Intergenic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1173245399 20:41334299-41334321 CAAGCAGAGAAGGGGCAGGACGG + Intergenic
1173473164 20:43339022-43339044 GAGACAGAGACGAGGGAGGGAGG + Intergenic
1173741347 20:45404895-45404917 CAAGCAGAAAAGAGGGAGAAGGG - Intronic
1173807993 20:45938745-45938767 CAGGCAGAGAAGAGGGGGAGGGG + Intronic
1173915882 20:46708775-46708797 CAGGGAGAGAGGAGGGAGATGGG - Intergenic
1174049677 20:47759003-47759025 GGGGCAGGGAAGAGGGAGGCGGG - Intronic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174130590 20:48341264-48341286 AAGGCAGGGAAGAGGGCTGCAGG - Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174501687 20:50989575-50989597 GAGGCAGAGAAGGAGGAGGCTGG + Intergenic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175124403 20:56740681-56740703 CAGCCAGAGAGGGGCGAGGCAGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175199214 20:57266457-57266479 GAGGCAGCGAGGAGGCAGGCGGG + Exonic
1175268111 20:57714797-57714819 AAGGCAGTGAGGAGGGAGACAGG - Intergenic
1175412415 20:58779129-58779151 GAAGCAGAGAAGAGGGAGCCTGG - Intergenic
1175434206 20:58931191-58931213 CACAGAGAGAGGAGGGAGGCAGG + Intergenic
1175446154 20:59021144-59021166 CACACAGAGAAGTGGGAGGCAGG + Intronic
1175487284 20:59355383-59355405 TAAGCAGAGAAGAGGAAGCCTGG - Intergenic
1175487367 20:59355675-59355697 GAGGGAGAGAGGAGGGAGGGGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175943561 20:62548764-62548786 CAGGCAGGGTTGAGGGGGGCAGG - Intergenic
1175980888 20:62738065-62738087 TAGGCAGAGGAGGGGGAGGGGGG - Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176365076 21:6027867-6027889 CAGCCAGAGAGGAGCCAGGCAGG - Intergenic
1177529568 21:22341899-22341921 GAGGAAGAGAAGAGGGGAGCAGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178580044 21:33830883-33830905 CTTGCAGAGAAGAGGGTGGGGGG + Intronic
1178667859 21:34564507-34564529 AAAGGAGAGAACAGGGAGGCAGG + Intronic
1178883587 21:36467375-36467397 CAGGCAGTCAAGACGCAGGCTGG - Intronic
1178911868 21:36681165-36681187 CTGCCAGAGAAGAGGGACCCTGG + Intergenic
1179505669 21:41838663-41838685 TAGGCAGAGAAGATGGGGGCGGG - Intronic
1179713353 21:43275413-43275435 CAAGCAGAGCAGATGGAGGGAGG - Intergenic
1179720908 21:43315599-43315621 CAGGCAGCCAGGAGGGAGGCTGG + Intergenic
1179758442 21:43510678-43510700 CAGCCAGAGAGGAGCCAGGCAGG + Intergenic
1180009489 21:45040261-45040283 CAGGCAGGAGAGAGGGTGGCGGG + Intergenic
1180102376 21:45594901-45594923 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102408 21:45594998-45595020 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102421 21:45595031-45595053 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180183036 21:46126480-46126502 CTGGAAGAGAGGAGAGAGGCCGG - Intronic
1180557879 22:16592240-16592262 CAGGCAGAGAATAGTGGGGACGG - Exonic
1181314508 22:21962710-21962732 AAGGCACAGAGGAGGAAGGCTGG + Intronic
1182073030 22:27476746-27476768 GAGGCCGAGAAGAGGGTGGGAGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182392875 22:30013991-30014013 AAGGCAGAGAAGAGAAATGCTGG - Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182762563 22:32734491-32734513 GGAGCAGAGAAGAGGCAGGCAGG + Intronic
1182911322 22:33987055-33987077 CTGGCAGAAAAGAGGAAGACAGG + Intergenic
1183086211 22:35488832-35488854 CAGGCAGAGATCTGGGAGGTGGG + Intergenic
1183107757 22:35627213-35627235 GAGGCAGGGCAGAGGGAGACAGG + Intronic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183493354 22:38128233-38128255 CAGCTGGAGAAGAGGGAGTCGGG + Intronic
1183566052 22:38616119-38616141 CTGGCAGAGAAGATGGAGAGGGG + Intronic
1183646263 22:39128774-39128796 AAGGCAGAGATGAGGATGGCAGG - Intronic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183730907 22:39617841-39617863 CTGGCAGAGAGCAGGGAGGGAGG - Intronic
1183781302 22:40000752-40000774 ATGGGAGAAAAGAGGGAGGCAGG - Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184035300 22:41915133-41915155 GAGGGAGAGAGGAGGGAGGGCGG + Intergenic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184521270 22:44995746-44995768 GAGACAGAGATGAGGGAGGGAGG + Intronic
1184526918 22:45029494-45029516 TAAGTAGAGAAGAGGGAGACTGG + Intergenic
1184558189 22:45244975-45244997 CTGGCACTGAAGAGGGAGGAAGG + Intergenic
1184642387 22:45879469-45879491 CAGGGAGGGAAGGGGGAGGGAGG - Intergenic
1184645988 22:45895783-45895805 CAGGCAGGGAAGGTGGAGGGTGG + Intergenic
1184749720 22:46478282-46478304 CTGGCAGGGAAGAGCGAGGCTGG - Intronic
1184956204 22:47888162-47888184 CAAGCAGAGAGGAGGGAACCAGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185219581 22:49622687-49622709 AAGGCAGTCAAGACGGAGGCTGG + Intronic
1185246833 22:49777168-49777190 GAGGAAGAGCAGAGGGAGTCAGG + Intronic
1185345616 22:50309354-50309376 CAGTCAGTGAAGAGGCAGGAAGG - Exonic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949301611 3:2590501-2590523 CAAGCAGAAAAGTGCGAGGCAGG - Intronic
949441086 3:4081322-4081344 CAGGCAGTGAAGAAAGAGGATGG - Intronic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949819125 3:8096013-8096035 CAGGCAGGGAGGAGGGCTGCAGG + Intergenic
949874700 3:8618580-8618602 CAGGCCTAGTTGAGGGAGGCTGG - Intergenic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950118602 3:10467320-10467342 CAAGCAGAGAAGCAGAAGGCAGG - Intronic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950436957 3:12985898-12985920 CAGGCAGAAAAGAAAGAGACAGG + Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950642636 3:14358486-14358508 GAGGCAGGGAGGCGGGAGGCAGG - Intergenic
950687893 3:14631903-14631925 GAGGGAGAGAAGAGGAAGGGAGG + Intergenic
950795352 3:15505984-15506006 CAGGTGGGGAGGAGGGAGGCTGG + Intronic
951485418 3:23203694-23203716 CAGGGAGAGAAGAGGCAGAAGGG - Intronic
951709551 3:25574574-25574596 ACGGCAGAGCAGTGGGAGGCCGG - Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
952717770 3:36497735-36497757 CAGGCAGAAAAAAGGAAGGGAGG + Intronic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953457493 3:43054556-43054578 GAGGCAGAGAGAAGGGAAGCTGG + Intronic
954132044 3:48565848-48565870 AAGGCAGAGGAGAGGGAAGTTGG + Intronic
954333476 3:49903110-49903132 TGGGCTGAGAAGAGGCAGGCTGG + Exonic
954444465 3:50539442-50539464 GAGGAAGAAAAGAGGGAGACAGG + Intergenic
954449553 3:50564254-50564276 CAGGCTGAGACTAGGGAGGATGG - Intronic
954462953 3:50638150-50638172 CAGGCAGTGAGGAGGGAGTGTGG + Intronic
954642796 3:52111832-52111854 CAGGGTGAGAAGTGGGAGACAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954837241 3:53480630-53480652 CAGGCAGAGAGAAGGGAGTCAGG + Intergenic
955028752 3:55196163-55196185 CAGGCAAAAAAGAGGGAACCAGG - Intergenic
955285351 3:57635497-57635519 TATGCAGAGAAGAGGGAGGGTGG - Intronic
955357859 3:58246440-58246462 CAGGCAGAGGAGGGACAGGCAGG - Intronic
955358318 3:58250378-58250400 CAGGCAAAGACGTGGGAGTCAGG + Intronic
955396003 3:58557941-58557963 TAGGCAGATAAGGGGGAGGGTGG + Intergenic
957801028 3:85081738-85081760 CAGGCAGAGAGGAGAAATGCCGG - Intronic
957851203 3:85809732-85809754 GAGGGAGAGAGGAGGGAGGGAGG - Intronic
957928457 3:86845820-86845842 CAGGCAGCATAGAGGGAGGGAGG - Intergenic
958856080 3:99387400-99387422 CACGCAGAGAAGAGAAAAGCAGG - Intergenic
959576380 3:107938890-107938912 CAGGCACAGAAGAGTCAGGAGGG - Intergenic
960201501 3:114842387-114842409 AAGGTAGAGATGAGGGAGGTTGG - Intronic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961468526 3:127096761-127096783 CAGGGAGTGATGGGGGAGGCTGG - Intergenic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961958121 3:130825381-130825403 AAGGCAGGGAGGAGGGAGGGAGG + Intergenic
962557133 3:136565035-136565057 CAGGCAGAAGGGAGGGAGGGAGG + Intronic
962906841 3:139811400-139811422 GAGGCAGAGAAGAGAGATGGAGG + Intergenic
962966308 3:140357633-140357655 CAGGCAGAAAAGAGGCCGCCAGG + Intronic
962987598 3:140549777-140549799 CAGCCAGAGAGGTGGGAGGAGGG - Intronic
962987761 3:140551232-140551254 CAGCCAGAGAGGTGGGAGGAGGG - Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
964344005 3:155737886-155737908 GAGGGAGAGAAGAGGGAAGTGGG + Intronic
964714646 3:159708979-159709001 AAGCCAGAGAACAGGGAGCCTGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965071994 3:163925904-163925926 CAGGCAGACATGAGCAAGGCAGG - Intergenic
965080130 3:164023272-164023294 TAAGAAGAGAAGAGGGAAGCGGG + Intergenic
965140744 3:164831472-164831494 CAGGTAGAGGAGTGTGAGGCAGG + Intergenic
965612035 3:170554648-170554670 GGGGCAGAGAATAGGGAGGAAGG - Intronic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
966839978 3:184080605-184080627 CTGGCAGAAAAGATGGTGGCAGG + Intergenic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
967044208 3:185721704-185721726 TAGACAGAGAAGAGGAAGACAGG - Intronic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968089775 3:195892796-195892818 GAGGCAGGCAAGAGGGAGGGCGG - Intronic
968266957 3:197369875-197369897 CGGGGAGAGAAGGGGGAGGGGGG - Intergenic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968514471 4:1010471-1010493 CAGGCCGAGGAGAGCTAGGCGGG - Intronic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968759728 4:2436547-2436569 CAGGCAGAGCAGAGAGTGCCAGG - Intronic
968762239 4:2448735-2448757 GAGGCAGGGAAGAGGGAAGGCGG + Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968910587 4:3475372-3475394 GAGGCAGAGAAGGGGGAGGTGGG + Intronic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969245859 4:5932324-5932346 CAGCCATCAAAGAGGGAGGCAGG + Intronic
969319443 4:6402864-6402886 GTGGCAGAGAGGAGGGAGGCAGG + Intronic
969462675 4:7337032-7337054 GTGGCTGAGAAGAGAGAGGCTGG + Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969509230 4:7608171-7608193 CAGGAAGTGACGAGGGAGGCTGG - Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
970369770 4:15395099-15395121 AAGGGAGAGAAGAGAGAGCCTGG + Intronic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970555091 4:17223576-17223598 TTGGCAGAGAAGAGAGAGGATGG + Intergenic
972413233 4:38813893-38813915 CAGACAGAGCTGAGGGTGGCTGG - Intronic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
973165639 4:47074450-47074472 CTGGCACAGAAGTGGGAGGCAGG + Intronic
973599851 4:52531513-52531535 CAGGTAGAGAAGGGGGAACCAGG - Intergenic
973909350 4:55563796-55563818 GAGGCAGAGAAGAGGAGGCCTGG + Intronic
974096684 4:57371814-57371836 CAGGCAGAGAAGAGGTAGATCGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975228464 4:71902925-71902947 CAGGCAGAAAGGAAGGAGGGAGG - Intergenic
975465560 4:74705260-74705282 CAAGCAGAGTTGTGGGAGGCAGG + Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
977163351 4:93664195-93664217 CAGGCAGAGAGCAGAGAGGGAGG + Intronic
977430794 4:96928470-96928492 CAGGGAGAGAAGACTGTGGCAGG - Intergenic
978426661 4:108590247-108590269 CAGGCATAGAATAGGGGGCCTGG - Intergenic
979814650 4:125085754-125085776 CAAGCAAAGAAGAGGGAGAGAGG - Intergenic
980060103 4:128119232-128119254 TAGGCAGAGAATAGGGATGCTGG + Intronic
980717355 4:136644373-136644395 CAGGAAGAAAAGGGGGAGGTTGG - Intergenic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
980857152 4:138454080-138454102 AAGGAACAGAAGAGGGAGACTGG - Intergenic
981026522 4:140082478-140082500 CAGGCAGGGAGGAAGGACGCTGG - Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
981435444 4:144715662-144715684 AAGGCAGAAAAATGGGAGGCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
982313157 4:154006175-154006197 CAGGCAGAGAAGGGAGAGGAAGG + Intergenic
983875037 4:172865736-172865758 GAGGGAGAGAAGAGAGAGACAGG - Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984863122 4:184257326-184257348 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984863145 4:184257402-184257424 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
985319946 4:188699762-188699784 GAGGCAGAGAAGAGGAGGCCTGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985569771 5:638627-638649 GAGGCAGAGATGGGGGAGGTGGG + Intronic
985627664 5:998235-998257 GAGGGAGGGAAGAGGGAGGGAGG + Intergenic
985634075 5:1027494-1027516 GAGGCAGAGGAGAGGGAGCGGGG - Intronic
985993735 5:3584754-3584776 AAGGAAGGAAAGAGGGAGGCAGG + Intergenic
985993794 5:3584987-3585009 GAGGAAGGAAAGAGGGAGGCAGG + Intergenic
985993828 5:3585118-3585140 GAGGAAGGAAAGAGGGAGGCGGG + Intergenic
986048583 5:4065262-4065284 AAAGCAGTGAAGAGAGAGGCTGG + Intergenic
986207424 5:5638156-5638178 CAGGGAGAGAAGTGGTAGGATGG - Intergenic
986253328 5:6081279-6081301 GAGGCAGAGAATGGAGAGGCTGG - Intergenic
986285273 5:6354389-6354411 GAGGCAGAGACTAGGGAGACAGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
986831818 5:11588876-11588898 CAGGGAGGGAGGAGGGAGGTGGG - Intronic
987070425 5:14332154-14332176 TAGGCAGAAAAGAGCGAGGGTGG - Intronic
987129977 5:14851187-14851209 CACCCAGAGAAAAGGAAGGCTGG + Intronic
987185647 5:15415651-15415673 AAGGAAGACAAGAGGGAGGACGG + Intergenic
987266659 5:16262899-16262921 GAGGCACAGAAGAGGAAGGTGGG - Intergenic
987434342 5:17875767-17875789 TAGGTAGAGATGAGGCAGGCTGG + Intergenic
989007678 5:36833407-36833429 AAGGCAGAGAAGAGGGTACCTGG + Intergenic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
989084902 5:37665891-37665913 GAAGCAGAGGAGAGGGTGGCGGG - Intronic
989246122 5:39256680-39256702 GAGGCAGAGAAGGGGAAGACAGG - Intronic
990487559 5:56274194-56274216 CAGGCAGAGAAGAGGAAAGAAGG - Intergenic
990631946 5:57680032-57680054 CAGGCACAGAAGAGGAGGTCTGG + Intergenic
991296801 5:65090186-65090208 CAGGCAGAGAAAAGGAAGAAAGG + Intergenic
991411278 5:66347921-66347943 GAGGAAGAGAGTAGGGAGGCAGG - Intergenic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
991927115 5:71716652-71716674 CAGATATAGAAAAGGGAGGCAGG - Intergenic
992844713 5:80735043-80735065 AAAGAAGAGAAGAGGGAGGCTGG + Intronic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
994076685 5:95659746-95659768 GAGGCAGGCAAGAAGGAGGCAGG - Intronic
995116212 5:108482430-108482452 TAAGCAGAGAAGAGGGAGTATGG - Intergenic
995827542 5:116317487-116317509 CAGGCAGAGAAAAAAGAGGGAGG - Intronic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996224092 5:120969270-120969292 AAGGCAGAGAAGCGGGAGTCTGG + Intergenic
996404194 5:123090231-123090253 GAGGCGGAGGAGAGAGAGGCGGG - Exonic
996559698 5:124815527-124815549 CAGGCAGTGACAAGAGAGGCTGG - Intergenic
996590272 5:125139010-125139032 CAGGCAGACATGATGGAAGCCGG - Intergenic
996746167 5:126848002-126848024 CTGGCAGTGAAGAGGAAGGCTGG - Intergenic
997210320 5:132073353-132073375 TGGCCAGAGAAGAGGAAGGCTGG + Intergenic
997226873 5:132215464-132215486 CAGGCGGAGAGGCGGGAGTCTGG + Intronic
997263490 5:132481185-132481207 CAGACACTGAAGAGGGAGACAGG + Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
997576320 5:134980349-134980371 AAGGAAGAGAGGAGGGAGGGAGG - Intronic
997595051 5:135101710-135101732 CAGGCAGTGAAGAGGGAGAGGGG + Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
997657540 5:135566625-135566647 CAGGCAGAGAGAAGGGAGCTGGG + Intergenic
997713763 5:136027705-136027727 GAGGCAGAGATGGGGAAGGCTGG - Intergenic
997748447 5:136320633-136320655 CAGGGAGAAAATGGGGAGGCTGG - Intronic
998054528 5:139063068-139063090 CAGGCAGACAAGAAGCAGGGAGG + Intronic
998069001 5:139181999-139182021 AAGGCAGAGAAGGGGGTGGAAGG + Intronic
998359641 5:141573839-141573861 CAGGCAAAGAAGAGGGTGAAGGG + Exonic
998424049 5:142012473-142012495 GGGGCAGGGATGAGGGAGGCGGG - Exonic
998520373 5:142794684-142794706 CAGGCAGATAGGAGGGAGAGAGG + Intronic
998541321 5:142984152-142984174 CAGGCAGGGAGAAGGAAGGCAGG + Intronic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
998819248 5:146043172-146043194 TAGGCAGAGAAGAGAGAAACTGG - Intronic
999142458 5:149371505-149371527 AAGGCATAATAGAGGGAGGCAGG + Intronic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001320435 5:170676138-170676160 GAGGGAGAGAAGGGGGAGGTAGG + Intronic
1001582164 5:172806289-172806311 CAGGAAGGGAAGGGGTAGGCAGG - Intergenic
1001931192 5:175674252-175674274 CAGCCAGTAAAGAGGCAGGCAGG - Intronic
1002176668 5:177404708-177404730 AAAGCAGATGAGAGGGAGGCAGG - Intronic
1002329606 5:178432568-178432590 GAAGCAGAGAACAAGGAGGCAGG + Intronic
1002471481 5:179438496-179438518 CTGGCAGTGAAGAGGGATCCTGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002980214 6:2128630-2128652 CAGGTAGAGGAGTGGGAGGAAGG - Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003130373 6:3390363-3390385 GGGGCAGAGAAGAGGGATGCAGG - Intronic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003153191 6:3570090-3570112 GAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1003550955 6:7101579-7101601 CAGGCAGAGAGGAGGGGGCAGGG - Intergenic
1003715589 6:8642659-8642681 CAGGCAGAGAAGAGGCACACAGG - Intergenic
1003775329 6:9354302-9354324 CAGGCAGAGACAAAGGAGGGAGG + Intergenic
1004273494 6:14215095-14215117 GAGGCAGGGAAGAGGGAGCAGGG - Intergenic
1004790386 6:19019745-19019767 AAGACAGAAAAGAGGGAGGAAGG + Intergenic
1004880196 6:19999913-19999935 CAGGAAGAGAAAAAGAAGGCAGG - Intergenic
1005441624 6:25875381-25875403 CTGGCTGAGAAGTGGGAGCCTGG + Intronic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1005959359 6:30684868-30684890 GAGGCTGAGAAGGAGGAGGCGGG - Exonic
1005968220 6:30742375-30742397 CAGGCGGAGAAGAGGTAGCTGGG - Intronic
1006017539 6:31094288-31094310 CAGGCAGAGAAAGAGGAGGTGGG + Intergenic
1006046738 6:31305421-31305443 CAGGCAGAGAGGAGGAAGTGTGG + Intronic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1006201252 6:32293552-32293574 CAGGTAGAGAAGAGTGAGATGGG - Exonic
1006243041 6:32703482-32703504 CAGGAAGAGAAGACGGAGGTTGG - Intergenic
1006911889 6:37568747-37568769 AAGGCAGGGAAGAGGGAGCCAGG + Intergenic
1006943051 6:37765636-37765658 CGGGGAGAGAGGAGGGTGGCGGG + Intergenic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007040091 6:38713886-38713908 CAGGCAGTGGACTGGGAGGCAGG + Intergenic
1007054808 6:38872015-38872037 CAGTAAGAGAAGAGGAAAGCAGG - Intronic
1007419535 6:41711501-41711523 CAGGCAGGGAAGAGAGATGCTGG - Intronic
1007741022 6:44009574-44009596 GAGGAAGGGAAGAGGGAGGAAGG + Intergenic
1007833209 6:44654640-44654662 CAGGCAGAGCAGCGGCAGGGAGG - Intergenic
1007836681 6:44679172-44679194 CAGGCAGATAGGAGTGATGCAGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008645945 6:53514905-53514927 CCTGCAGAGATGAGGGAGGGAGG - Intronic
1008722046 6:54366577-54366599 GAGATAGAGAAGAGGGAGGGAGG + Intronic
1009835476 6:68995774-68995796 CAGGCAGAGATGGGAGAGGAAGG - Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011403756 6:86993655-86993677 CAGGGAGAGAAGAGGAGTGCTGG - Intronic
1011410260 6:87059796-87059818 GAGGCAGGGAGGAGGCAGGCTGG + Intergenic
1011414280 6:87101351-87101373 GAGGCAGAGAAAGGGGAGGGAGG - Intergenic
1011740097 6:90350871-90350893 GTGGCAGAGGAGAGGGAGGGAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012160088 6:95873645-95873667 CATGCTGAGAAGAGTGAGGGAGG + Intergenic
1012260645 6:97083500-97083522 CAGGCAGAGAAGAGCAAGGGCGG - Intronic
1012313525 6:97757155-97757177 CAGGGAGAGAAGAGAAGGGCTGG - Intergenic
1012549313 6:100453254-100453276 TAGGAAGAGAAGAGGGAGCCTGG + Intronic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1013216612 6:108033118-108033140 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1013815268 6:114090440-114090462 AGGACAGAGAAGAGGGAGGAGGG - Intronic
1014479359 6:121916325-121916347 CAGGCAGATATAAGGGGGGCAGG - Intergenic
1015117438 6:129665103-129665125 CAGGCATAGAAGAGGGAAAGTGG - Intronic
1015283787 6:131462140-131462162 CATGTGGAGAAAAGGGAGGCTGG + Intergenic
1015442834 6:133268796-133268818 CAGGAGGAGAAGAGGGAGAGTGG + Intronic
1015666873 6:135640776-135640798 AAGGCAGAGAAGAGGTTAGCAGG - Intergenic
1015685669 6:135856954-135856976 AAGGAAGAGAGGAGGGAGGAAGG - Intronic
1015819920 6:137249870-137249892 GAGGCAGTGAAGAGGGAGCCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018619737 6:165718579-165718601 CAGGAAGAGAGCAGGGAGGTTGG - Intronic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019216780 6:170448941-170448963 CAGGAAGAGAAGAGTCAGGCTGG + Intergenic
1019230492 6:170557096-170557118 GAGGGAGAGAATAGGGAGGGCGG + Intronic
1019327598 7:445967-445989 AAGGGAGAGAGGAGGGAGGATGG + Intergenic
1019355535 7:576909-576931 CAGGCCGAAAAGCAGGAGGCTGG - Intronic
1019381823 7:727796-727818 CAGGCAGGGAGGAGGGTGGGAGG - Intronic
1019478628 7:1255956-1255978 CTGGCAGATCAGAGGCAGGCGGG + Intergenic
1019483492 7:1277047-1277069 AAGGAAGGGAAGAGGGAGGGAGG - Intergenic
1019508303 7:1404665-1404687 CAGGCAGAAATGAGGGACCCTGG + Intergenic
1019537848 7:1538318-1538340 CAGCCAGAGACCAGGGAGGTGGG - Intronic
1019552469 7:1610026-1610048 CAGGAGGAGAAGCGGGGGGCTGG + Intergenic
1019647179 7:2137201-2137223 CAGGAAGAGAATAGGGAGATGGG - Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019772325 7:2891478-2891500 CACGTAAAGAGGAGGGAGGCGGG - Intergenic
1019947736 7:4343276-4343298 CAGGCAGTGAGAAGGGAGGAAGG + Intergenic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020440229 7:8209787-8209809 CAGGCACAAAAGAGGGAGAAGGG + Intronic
1021224704 7:18013640-18013662 CATGCAGGGAAGAGGAAGGAGGG + Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1021652505 7:22845779-22845801 GAGGCAGAAAAGAGGCAGGCTGG + Intergenic
1022243582 7:28535403-28535425 AAGGAAGAAGAGAGGGAGGCAGG + Intronic
1022267861 7:28775222-28775244 CAGGCAGAGAGGAAGCAGGAGGG - Intronic
1022451580 7:30520807-30520829 CAGCCAGAGTGGAGAGAGGCAGG + Intronic
1022520794 7:31005674-31005696 GAAGGAGAGAAGAGGGAGGCAGG + Intergenic
1022661728 7:32374059-32374081 TAGGCAGGAAAGAGGGAGGAGGG + Intergenic
1023191849 7:37591529-37591551 CAGGCAGAGATGAGGCTGGGTGG - Intergenic
1023345236 7:39265038-39265060 CAGGCAGAGAAAAGCCAGCCTGG + Intronic
1023727998 7:43164045-43164067 CAGGCAGCGAAGAGAGCGGTTGG + Intronic
1025120858 7:56300741-56300763 GAGGAAGGGAAGAGGGAGGGAGG + Intergenic
1025247510 7:57328498-57328520 CAGGCAGAGGAGAGAGAGAAAGG - Intergenic
1025611394 7:63078066-63078088 CAGGCAGAGAGGGGGTAGGCTGG - Intergenic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1026428975 7:70325098-70325120 AAAGGAGAGAAGTGGGAGGCTGG + Intronic
1026479538 7:70765913-70765935 CAGCTAGAGAACAGGGAGACAGG + Intronic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026529516 7:71185022-71185044 GAGGAAGAGAAGAGGAAGGAAGG - Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027270350 7:76515359-76515381 AAGGCAGAGGAGAGGCAGGGGGG - Exonic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028752067 7:94393647-94393669 CGGCCAGAGAAGAGGGAAGTTGG + Intergenic
1028960471 7:96743505-96743527 CAAGCAGGGACGTGGGAGGCAGG - Intergenic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029443668 7:100601487-100601509 AAGGGAGAGAGGAGGGGGGCTGG - Intergenic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029926900 7:104328388-104328410 CGGGCAGCGGGGAGGGAGGCGGG + Intergenic
1030095532 7:105895195-105895217 CAAGGAGAGAAGAGAGAAGCAGG + Intronic
1030318583 7:108141355-108141377 CAGGCATACAGGTGGGAGGCTGG + Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030547651 7:110917670-110917692 AAGGCAAAGAATAGGGAGACGGG + Intronic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1030643394 7:112031436-112031458 AGGACAGAGAAGAGGGAGGGAGG - Intronic
1030970099 7:116045802-116045824 AAAGCAGCCAAGAGGGAGGCTGG + Intronic
1031310757 7:120194397-120194419 CAGGAAGAAAAGAGTGAGGGAGG - Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032085238 7:128880292-128880314 CAGGCATCAGAGAGGGAGGCTGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032122654 7:129168357-129168379 CAGGCAGTGAGGAGAGAGCCTGG + Exonic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1033136151 7:138786128-138786150 GAGGTGGAGAAGAGGGAAGCTGG - Intronic
1033223727 7:139544881-139544903 AAGGCAAAGAAGGGGGATGCAGG - Exonic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034409633 7:150933314-150933336 GAGGCAGGGTAGAGGGAGGTGGG - Intergenic
1034436323 7:151064377-151064399 CAGGCAGGGGAGGGGGAGGTGGG + Intronic
1035072932 7:156158014-156158036 CCGGCAGAGACGAGGGAGCTGGG + Intergenic
1035100222 7:156389977-156389999 GAGGGAGAGAAGGGGGAGGAAGG - Intergenic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1035594765 8:848083-848105 CAGACAGAGAACAGGCAGGCAGG - Intergenic
1035638870 8:1167388-1167410 AAGGCAGAGAGGGGTGAGGCTGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036125396 8:6057484-6057506 CAGGCAGAGCAGGGCGGGGCTGG - Intergenic
1036636122 8:10550636-10550658 CAGGCAGGAGAGAGGAAGGCTGG - Intronic
1036943010 8:13069355-13069377 TAGGCAGAGAACAGAGAGGTGGG - Intergenic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037629696 8:20643469-20643491 CAGGAAGAGAGGAGAAAGGCAGG - Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1038311977 8:26451626-26451648 AAGGGAGGGAAGAGGGAAGCTGG + Intronic
1038507650 8:28099383-28099405 CAGGAAGACAAGAAGAAGGCTGG + Intronic
1038596001 8:28887182-28887204 CAGGCAAAAAAGAGTGAGGCAGG + Intronic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1038779477 8:30557762-30557784 AAGGAAGAGCAGTGGGAGGCGGG + Intronic
1039065974 8:33607804-33607826 AAGGAAGAGAGGAGGGAGGAGGG - Intergenic
1039552338 8:38452031-38452053 GAGGGAGAGGGGAGGGAGGCTGG + Intronic
1039568161 8:38565574-38565596 GAGGCAGGGAGGAGGGAGACAGG - Intergenic
1039600564 8:38833502-38833524 CAGGCAGAGAGGAGAGTGGCTGG + Intronic
1039707638 8:40023525-40023547 CTGGCAAAGATGAGGTAGGCAGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040570240 8:48602144-48602166 AAGACAGAGAAGGAGGAGGCGGG - Intergenic
1041444152 8:57931800-57931822 GAGGAAGGGAAGAGGGAGGGAGG + Intergenic
1041444171 8:57931867-57931889 GAGGAAGGGAAGAGGGAGGGAGG + Intergenic
1041447142 8:57964770-57964792 CAGGCAGAGAAGAGAGAAAAGGG + Intergenic
1041912473 8:63103495-63103517 CAGGCACAGAAGAGAGAGGTGGG + Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042007061 8:64192864-64192886 GAGGCAGAGAAAAGGGAGCAGGG - Intergenic
1042190838 8:66185588-66185610 TAGGCAGAGAAGATGGAAGCAGG - Intergenic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1043182517 8:77103877-77103899 CAGGCAAAGAAGTGGTGGGCGGG - Intergenic
1043192844 8:77248508-77248530 AAGGCAGAGAAGAGGAGGCCTGG + Intergenic
1044119952 8:88382477-88382499 AAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1044715915 8:95099383-95099405 CAGGCAGAGAATATGGAGGAAGG - Intronic
1044818931 8:96143132-96143154 CAGGCAGTGAGGAAGGAGACAGG - Exonic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045295352 8:100867723-100867745 GAGGCAGAGAACAGGGAAGGGGG + Intergenic
1045559869 8:103250738-103250760 CAGACAGTGAAGAGGAAGGCTGG - Intergenic
1046584046 8:116129672-116129694 GAGGCTGAGAAGAGGGAGAAGGG + Intergenic
1046682231 8:117183103-117183125 CAGGTGGAGAGGTGGGAGGCTGG + Intergenic
1046719982 8:117608439-117608461 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1046745942 8:117875909-117875931 CAGGCAGGGAAGAGGGCAACTGG + Intronic
1046767299 8:118083729-118083751 CAATAAGAAAAGAGGGAGGCGGG + Intronic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047349669 8:124061756-124061778 AAGGCAGAGACAAGGGAGACTGG + Intronic
1047384878 8:124399657-124399679 GAGACACAGAAAAGGGAGGCTGG + Intergenic
1048639138 8:136333509-136333531 CAGGCAGACATGAGTGGGGCAGG + Intergenic
1049208929 8:141376440-141376462 CAGGAAGAGGTGAGGGAGCCTGG + Intergenic
1049243012 8:141548311-141548333 CTGGCAGAGAACACGCAGGCAGG + Intergenic
1049284889 8:141769227-141769249 CAGGCAGAGGCGAGGTTGGCAGG + Intergenic
1049303561 8:141884714-141884736 GAGGCAGAGAAGAGGTGGGCGGG - Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049446208 8:142632688-142632710 CACTCAGAGAAGAGGGATCCTGG - Intergenic
1049495086 8:142926317-142926339 AAGGCATAGAGGAGGGAGGACGG - Intergenic
1049566349 8:143341130-143341152 CAGCACGAGAAGAGGGTGGCGGG - Intronic
1049766883 8:144359027-144359049 CAGGCAGGGAAGCAGGAAGCCGG - Exonic
1050163356 9:2740448-2740470 CAGTTAGTGAAGAAGGAGGCAGG + Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051265732 9:15307009-15307031 CCGGGAGAGAAGAGTGAGCCCGG - Intronic
1051381127 9:16459675-16459697 CATACAGTGAAGACGGAGGCTGG + Intronic
1051605879 9:18917445-18917467 AAGGGAAAGAAAAGGGAGGCAGG + Intergenic
1051668136 9:19484462-19484484 CAGCCGGAGAAGCTGGAGGCTGG + Intergenic
1051681403 9:19611413-19611435 AGGGCAGAGAAGAGGGAAGGAGG + Intronic
1052024661 9:23561221-23561243 TGGGCAGGGAAGAGGGAGGCTGG + Intergenic
1052285651 9:26782037-26782059 CATGCAGAGAACAGGGAGGTAGG + Intergenic
1052840520 9:33288778-33288800 GAGGCAGAGGAGAGGCAGGGAGG - Intergenic
1052856141 9:33407860-33407882 TGGGCAGAGATGAGGGAGTCGGG - Intergenic
1052861822 9:33442251-33442273 AGGGCAGAGGAGAGGCAGGCTGG + Intronic
1052869657 9:33491678-33491700 AAGGCAGAGAAGTGGGTTGCGGG - Intergenic
1052984784 9:34478964-34478986 AAGGAAGAGTAGAGGGAGGTAGG + Intronic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053139655 9:35674592-35674614 ATGGGAGAGAAGGGGGAGGCTGG + Intronic
1053379307 9:37636009-37636031 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
1053754652 9:41293299-41293321 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054260173 9:62857603-62857625 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054712254 9:68523128-68523150 CAGGCAGCCAATAGAGAGGCTGG - Intronic
1054799736 9:69335412-69335434 CAGGCAGCTAGGAGGGAAGCTGG + Intronic
1055492032 9:76815136-76815158 CAGGTAGAGAAGATTGGGGCGGG - Intronic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056259486 9:84833632-84833654 CAGGAAGGAAGGAGGGAGGCAGG + Intronic
1056403867 9:86255565-86255587 CAGGGAGAGAAGAGGAGGCCTGG - Intronic
1056595832 9:88007033-88007055 CAGCCAGCGAGTAGGGAGGCCGG + Intergenic
1056650894 9:88461142-88461164 CAGGCAGAAATGAGGGCGGCAGG - Intronic
1056919280 9:90771947-90771969 CAGGCACTGAAGAGGGAAGTGGG + Intergenic
1056934949 9:90909283-90909305 AAGGCTGAGAATGGGGAGGCAGG - Intergenic
1057163493 9:92908067-92908089 AAGGCAGGAAAGAGGGAGGGAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1057810520 9:98253649-98253671 CAAGCAGACAAGAGGGAGAAAGG - Intronic
1057949286 9:99356901-99356923 TGGGCAGAGGAGAGGGAGGTGGG + Intergenic
1058171777 9:101690097-101690119 CAGGCTCAGAAGAGAGAGGTGGG + Intronic
1058811017 9:108639601-108639623 AAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1059296785 9:113277760-113277782 GAGGCTGAGAAGCGGGAGTCTGG + Intronic
1059309919 9:113381282-113381304 GAGAGAGAGAAGAGGGAGGGAGG - Intergenic
1059354229 9:113687081-113687103 AAGGCAGAGAAGAGGAAAGGAGG + Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059354288 9:113687278-113687300 TAGGCAGAGAGGAGGGAAGAGGG + Intergenic
1059409731 9:114124374-114124396 GAGGCAGAGGAGGGGGAGGAGGG + Intergenic
1059466255 9:114470627-114470649 CAGGGACAGAACAGAGAGGCTGG + Intronic
1059664290 9:116431281-116431303 AAGGCAGGGAGGAGGGAGGGAGG - Intronic
1059780955 9:117526729-117526751 CAAGGAGAGAAGAGAGAGACGGG - Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060007441 9:120013216-120013238 CAGGCAGAGAATAGAGAGCTTGG + Intergenic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060934140 9:127506045-127506067 CAGGCGGGCAGGAGGGAGGCAGG + Exonic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061218990 9:129238012-129238034 CAGGCAGGGAGGTGGGAGCCAGG - Intergenic
1061257987 9:129463886-129463908 ATGGCAGTGAAGAGGGAAGCTGG - Intergenic
1061274169 9:129559795-129559817 AGGGAAGAGAAGAGGGAGGCAGG + Intergenic
1061492592 9:130954330-130954352 AAGGCTGAAATGAGGGAGGCAGG - Intergenic
1061695646 9:132371335-132371357 CTGGCAGAGATGAGGAAGCCCGG + Intergenic
1061777920 9:132978117-132978139 GAGGCAGCGAGGAGGGAGGCAGG + Intronic
1061802472 9:133120090-133120112 CAGGCAGAGCAGGGCGAGGGGGG + Intronic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1061927915 9:133815189-133815211 GGGCCAGGGAAGAGGGAGGCGGG - Intronic
1062033834 9:134373977-134373999 CAGGCAGAGAAAAACCAGGCTGG - Intronic
1062055861 9:134469513-134469535 CAGGGAGAGAAGAGACAGGGAGG - Intergenic
1062153595 9:135033936-135033958 CAGGCAGGGGACAGGGTGGCTGG - Intergenic
1062191352 9:135249465-135249487 TAGGCAGGGCAGAGTGAGGCTGG - Intergenic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062585254 9:137246323-137246345 CGGGAAGAGAACTGGGAGGCAGG + Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1202798964 9_KI270719v1_random:155316-155338 CAGACAGTGAAGAAGGTGGCAGG + Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185610888 X:1392974-1392996 GAGGGAGGGAGGAGGGAGGCGGG - Intergenic
1185611165 X:1394462-1394484 AAGGCAGGAAAGAGAGAGGCAGG - Intergenic
1185773435 X:2783477-2783499 CAGGCAGAGCAGCGTGAAGCTGG + Intronic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186680124 X:11864123-11864145 CAGGCAGAGGAGGGGAAGACTGG + Intergenic
1186863202 X:13693464-13693486 TAGGCAGAGGGGAGGGAGGTCGG + Intronic
1186913694 X:14197065-14197087 CAAGCAAAGAAGATAGAGGCTGG - Intergenic
1186967332 X:14802206-14802228 CAGTCAGACAAGGGGGAGGAAGG + Intergenic
1187452606 X:19412075-19412097 CAGGCACAGAAATGGGAGCCAGG + Intronic
1187476157 X:19612919-19612941 AAGGAAGAGAAGAGGGAGAGAGG + Intronic
1188620745 X:32220105-32220127 CAGGCCCACAAGAGGGAGGCAGG + Intronic
1188945025 X:36290044-36290066 GAGGAAGAGAAGAGGGAGGGAGG - Intronic
1189058778 X:37729256-37729278 CAGGCAAGGAATGGGGAGGCAGG - Exonic
1189251291 X:39602257-39602279 CTGGCGGGGAGGAGGGAGGCTGG + Intergenic
1189294904 X:39911064-39911086 AAGCCAGGGAAGAGGGAGTCAGG - Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1192206504 X:69100291-69100313 CAAGCAGAGACAAGGGAGGAAGG + Intergenic
1192831079 X:74751678-74751700 AAGGAAGAAAAGAGGGAGGGAGG - Intronic
1192831092 X:74751727-74751749 AAGGAAGAAAAGAGGGAGGGAGG - Intronic
1193066606 X:77267202-77267224 CAGGCAGACATGAGCAAGGCAGG + Intergenic
1193328314 X:80207625-80207647 CAGGGAGAGAACAAGGAGGTGGG - Intergenic
1193649086 X:84108782-84108804 TAGGCAGGGAGCAGGGAGGCTGG + Intronic
1194114020 X:89873701-89873723 CAGGGAGGGAATGGGGAGGCTGG - Intergenic
1194206817 X:91019878-91019900 CAGGCAGGGAACATGGAGGCAGG - Intergenic
1194362066 X:92964463-92964485 GAGGCAGACAAAAGGGAGGAGGG + Intergenic
1195934621 X:110113027-110113049 AAGGCAGAGGGGAGGGAGGGAGG - Intronic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197863643 X:130995984-130996006 AAGAGAGAGAAGAGGCAGGCAGG - Intergenic
1198141374 X:133807254-133807276 AAGGAAGAGAAGAGAGAGGGTGG - Intronic
1199480488 X:148292962-148292984 CAGGCAGAGAAGGCAGAAGCTGG - Intergenic
1199608591 X:149595318-149595340 CAGGCCGAGGAGAGGCAGGAAGG - Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199630531 X:149774042-149774064 CAGGCCGAGGAGAGGCAGGAAGG + Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200397249 X:155998470-155998492 CAGGAAGAGAAAATGGGGGCAGG - Intronic
1200466760 Y:3529057-3529079 CAGGGAGGGAATGGGGAGGCTGG - Intergenic
1200552568 Y:4594667-4594689 CAGGCAGGGAACATGGAGGCAGG - Intergenic
1200670315 Y:6080678-6080700 GAGGCAGACAAAAGGGAGGAGGG + Intergenic
1201296438 Y:12467085-12467107 CAGGCAGAGCAGCGTGAAGCTGG - Intergenic
1201550379 Y:15211784-15211806 AAGGAAGGGAAGAGGGAGGGAGG + Intergenic
1201609375 Y:15823676-15823698 CAGGCACAGAATGGGGAGGTGGG + Intergenic
1201630213 Y:16063500-16063522 ATGGCAGAGAAGAGGGAGAGTGG + Intergenic
1201741051 Y:17325200-17325222 GAAGGAGAGAGGAGGGAGGCAGG + Intergenic