ID: 926145741

View in Genome Browser
Species Human (GRCh38)
Location 2:10396307-10396329
Sequence AGCCTCCACGGTTTCTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926145741_926145755 26 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145755 2:10396356-10396378 CAGTCGTGGGTGGCAGGCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 168
926145741_926145745 -6 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145745 2:10396324-10396346 GAGGCTGGAGAGACCCTGAAGGG 0: 1
1: 0
2: 2
3: 45
4: 364
926145741_926145750 12 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145750 2:10396342-10396364 AAGGGAGCAGGGCACAGTCGTGG 0: 1
1: 0
2: 0
3: 16
4: 285
926145741_926145751 13 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145751 2:10396343-10396365 AGGGAGCAGGGCACAGTCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 237
926145741_926145744 -7 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145744 2:10396323-10396345 GGAGGCTGGAGAGACCCTGAAGG 0: 1
1: 0
2: 4
3: 50
4: 484
926145741_926145752 16 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145752 2:10396346-10396368 GAGCAGGGCACAGTCGTGGGTGG 0: 1
1: 0
2: 0
3: 24
4: 275
926145741_926145746 0 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145746 2:10396330-10396352 GGAGAGACCCTGAAGGGAGCAGG 0: 1
1: 0
2: 6
3: 67
4: 347
926145741_926145747 1 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145747 2:10396331-10396353 GAGAGACCCTGAAGGGAGCAGGG 0: 1
1: 0
2: 1
3: 42
4: 394
926145741_926145754 25 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145754 2:10396355-10396377 ACAGTCGTGGGTGGCAGGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 194
926145741_926145753 20 Left 926145741 2:10396307-10396329 CCAGTCAAGAAACCGTGGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 926145753 2:10396350-10396372 AGGGCACAGTCGTGGGTGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926145741 Original CRISPR AGCCTCCACGGTTTCTTGAC TGG (reversed) Intronic