ID: 926145854

View in Genome Browser
Species Human (GRCh38)
Location 2:10396844-10396866
Sequence CTAGTGGCCCAGTCAGGACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926145845_926145854 16 Left 926145845 2:10396805-10396827 CCTGCGTGACCTGTCGCTCTTCT 0: 1
1: 0
2: 0
3: 2
4: 62
Right 926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
926145847_926145854 7 Left 926145847 2:10396814-10396836 CCTGTCGCTCTTCTCTTCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 214
Right 926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
926145844_926145854 30 Left 926145844 2:10396791-10396813 CCGGGTCGTCACAGCCTGCGTGA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG 0: 1
1: 0
2: 1
3: 7
4: 88
926145852_926145854 -10 Left 926145852 2:10396831-10396853 CCAGGGGCATGGTCTAGTGGCCC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG 0: 1
1: 0
2: 1
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926145854 Original CRISPR CTAGTGGCCCAGTCAGGACG CGG Exonic
900411666 1:2515356-2515378 CTGGTGGGTCAGTGAGGACGTGG - Intronic
902048251 1:13542014-13542036 CTGGTGGCCCCGTCAGCACCTGG - Intergenic
903190024 1:21651190-21651212 CCAGTGGCCCAGGGAGGAGGAGG + Intronic
905634081 1:39537636-39537658 CTAGAGGCCCAGCCATGAAGAGG - Intergenic
907460883 1:54604799-54604821 CCAGTGGCACAGGCAGGAAGTGG - Intronic
914672903 1:149885654-149885676 CTTGTCGCCCAATCAGGACAAGG + Exonic
914848164 1:151294192-151294214 CTGGTAGGCCAGTCAGGACAGGG - Intronic
916488020 1:165276586-165276608 TTAGTGGCCCAGTCAGGACAGGG - Intronic
920224444 1:204427983-204428005 CTAGTTTCCCACTCAGGCCGTGG - Intronic
921050626 1:211508885-211508907 TGGGTGGCCCAGTCAGGAGGAGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1069669440 10:70189373-70189395 CTAGTGGCACAGTCATGACATGG + Intergenic
1069895827 10:71679510-71679532 CTCGGGGCCCAGCCAGGAGGAGG + Intronic
1075976592 10:126701430-126701452 GTAGAGGCACAGCCAGGACGTGG + Intergenic
1079941304 11:26683939-26683961 CAAATGGCACAGTCAGGACTAGG - Intronic
1081969161 11:47186348-47186370 CGAGGGGCCCAGGGAGGACGCGG - Intronic
1082785311 11:57313367-57313389 CCAGTCACCCAGTCAGGACCAGG - Exonic
1090360863 11:126171802-126171824 CTTGGTGCCCAGTCAGGATGTGG - Intergenic
1103918174 12:124386497-124386519 CTAAAGGCCCACTCAGGACTCGG + Intronic
1104861737 12:131927692-131927714 CTGGTGGCCGAGGCAGGAAGGGG - Intergenic
1108128276 13:47268879-47268901 CTAGTGGGCAAGTCAAGACTGGG - Intergenic
1118768535 14:68926407-68926429 CTAGTGGCTCAAACAGGAAGAGG + Intronic
1121425853 14:93851492-93851514 CAAGTGGCACAGTTAGGAAGAGG + Intergenic
1127284745 15:57522505-57522527 GTAGTGGCCCAGTCAGCCCTCGG + Intronic
1128518150 15:68356757-68356779 CAAGAGGCCCAGGCAGGACCTGG - Intronic
1129341795 15:74891177-74891199 CTAGAGGCCGAGTCTGGACAAGG + Intronic
1129671016 15:77607710-77607732 CTAGTGGCCCAGCAGGGACCAGG + Intergenic
1130550636 15:84888245-84888267 CAAGTGGCCAGGTCAGGTCGAGG + Intronic
1132956565 16:2597419-2597441 CTAGTGGCTCAGTCCTGAGGGGG + Intronic
1133434617 16:5768455-5768477 CACGTGGCCCTGTCAGGAAGGGG + Intergenic
1135355835 16:21768324-21768346 CTAGTAGCCCAGTCAGGGCAGGG - Intergenic
1135454325 16:22584462-22584484 CTAGTAGCCCAGTCAGGGCAGGG - Intergenic
1140790928 16:78390290-78390312 CTAATGGTCCAGTTAAGACGTGG - Intronic
1141026860 16:80556880-80556902 CTAATGGGCCTGTCAGGAGGTGG + Intergenic
1141075863 16:81006507-81006529 CTGGTGGCCGAGACAGGCCGTGG - Intronic
1146134736 17:30309317-30309339 TTAGTGGCTGAGTCAGGATGAGG + Intergenic
1146639088 17:34526723-34526745 CTAGTCACCCAGCCAGGAAGTGG + Intergenic
1148509512 17:48156728-48156750 CCAGTGGCACAGTCAGCAGGAGG - Intronic
1149536593 17:57438244-57438266 CAGGTGGCCCAGTCAGGGAGAGG - Intronic
1152218176 17:79046576-79046598 ATACAGGCCCAGTCAGGACCAGG + Exonic
1152782426 17:82232177-82232199 TTTGTGGCCCAGGCAGGAGGCGG - Intronic
1153518158 18:5924336-5924358 CTAGTGGCCCAACCAGGGCCAGG - Intergenic
1155523329 18:26691104-26691126 CATGTGACCCAGTCAGAACGAGG + Intergenic
1156921793 18:42531103-42531125 CTGGTGGCTCAGTCATGACCTGG + Intergenic
925339639 2:3127184-3127206 CTCCTGGCCCAGGCAGGATGAGG - Intergenic
926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG + Exonic
933973727 2:87490833-87490855 CTAGTGGCCAAGTCAGGCCACGG - Intergenic
935438921 2:103068861-103068883 CTGGTGGCCCAGGAAGCACGTGG + Intergenic
936319997 2:111459381-111459403 CTAGTGGCCAAGTCAGGCCACGG + Intergenic
949017751 2:241723013-241723035 CTGGTGGCACAGGCAGTACGTGG - Exonic
1173014643 20:39214272-39214294 CAAGTAGCCCAGTCTGGACAAGG + Intergenic
1173976352 20:47189531-47189553 ATAGTGGACCAGGCAGGACCTGG + Intergenic
1174824579 20:53757780-53757802 CTGGTGCCTCAGTCAGGAGGTGG - Intergenic
1177045009 21:16158293-16158315 CCAGTGGGCTAGTCAGGACAGGG + Intergenic
1179307331 21:40166796-40166818 TTAGTGGCACAGTGAGGACTTGG + Intronic
1181670507 22:24423731-24423753 CAGGTGTCCCTGTCAGGACGAGG - Intronic
1185322324 22:50207514-50207536 CTGGTGTCCCGGGCAGGACGGGG - Intronic
949844738 3:8357901-8357923 CAAGTGTCCCAGTGAGGACAGGG - Intergenic
950615314 3:14153241-14153263 CAGGTGGCCCAGCCAGGAAGTGG - Intronic
961209423 3:125114255-125114277 CTAGTGGGCCACTCAGCACCTGG - Intronic
961644967 3:128388028-128388050 CTAGTGGCCCAGCCAGCCCCTGG + Intronic
968661598 4:1800999-1801021 CTAGTGGACAAGCCAGGACCTGG - Intronic
969053747 4:4389057-4389079 CTGGGGGCCCAGGCAGGAGGGGG - Intronic
976591727 4:86855775-86855797 CTAGAGGCCAAGTCAGGACCTGG + Intergenic
981615034 4:146637369-146637391 CGGGTGGCCCAATCCGGACGGGG - Intergenic
986410580 5:7475060-7475082 CCAGAGGCCCAGGCAGGAGGTGG - Intronic
987034649 5:14007439-14007461 CTGGTGGCCCAATCTGGAAGCGG + Intergenic
988093349 5:26569701-26569723 AGAGTGGCCCAGTGAGAACGTGG - Intergenic
993818341 5:92581462-92581484 CTACTGGGCCAGACAGGATGGGG + Intergenic
995589576 5:113685483-113685505 CTAGTGGGCCAGTCATCACTTGG + Intergenic
997657853 5:135568620-135568642 CTAGAGCCACAGGCAGGACGAGG + Intergenic
1001085820 5:168699411-168699433 CTGGTGAGCCAGTCAGGAGGCGG - Intronic
1001550816 5:172601120-172601142 CTAGTTGCCCAGTCAAGGAGGGG + Intergenic
1006183474 6:32167499-32167521 CTAGTGGGCCGGTCAGGCTGGGG + Exonic
1006447665 6:34088918-34088940 CCAGTGGCCCAGTCAGTATTGGG + Intronic
1006516462 6:34548329-34548351 CAAGGAGCCCAGTCAGGAGGTGG - Intronic
1006790386 6:36697558-36697580 TTAGTGGCACAGCCAGGACTGGG - Intergenic
1007778149 6:44235381-44235403 CCAGTGGGCCAGGCAGGAGGTGG - Intergenic
1010794946 6:80107245-80107267 CTAGTGGCCCAGTCCTGGCCAGG - Intronic
1011252601 6:85388564-85388586 GTAGTGGCACAGTCAGAACAAGG - Intergenic
1016964979 6:149710431-149710453 CAATAGGCCCAGTCAGGACTTGG - Intronic
1018968641 6:168509052-168509074 CTAGTTGGCCGGTCAGGAAGTGG + Intronic
1021778898 7:24082612-24082634 CTAGTGGACCTGTAAGGAGGGGG - Intergenic
1025185345 7:56853527-56853549 CTGGTGGCCAAGGCAGGTCGGGG + Intergenic
1037510323 8:19576015-19576037 CTAATGGCTCAGACAGGAAGAGG + Intronic
1043020080 8:74989220-74989242 CTTGTGGCAGAGTCAGGAAGGGG + Intronic
1045506248 8:102780889-102780911 CGAGTGACCCAGTGAGGAAGAGG + Intergenic
1049614607 8:143570666-143570688 CAAGTGGCCCACTCAGGCCTGGG + Intronic
1057142861 9:92738108-92738130 CCAGTGGCAGAGCCAGGACGTGG - Intronic
1057222632 9:93265556-93265578 TCAGTGGCCCAGTGAGGACCTGG - Intronic
1058166668 9:101626812-101626834 CAAGTGGCAGAGTCAGGACTAGG - Intronic
1061448584 9:130656235-130656257 CCGGGGGCCCAGTCAGGATGTGG - Intergenic
1062300434 9:135864625-135864647 CTGGTGGCCCATTCTGGAAGCGG - Intronic
1062540582 9:137040113-137040135 CCAGTGGCCCAGTCTGGAAGTGG + Intronic
1062631200 9:137463950-137463972 CTAGGGGCACAGACAGGAGGGGG - Intronic
1192143911 X:68667806-68667828 CGAGTGGCACAGTCAAGACTGGG - Intronic
1194666707 X:96684554-96684576 CTAGTGGCCCAGCGAGAACAGGG - Intergenic