ID: 926146271

View in Genome Browser
Species Human (GRCh38)
Location 2:10398727-10398749
Sequence TGCCTTCCTCTTCCTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 301}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926146255_926146271 19 Left 926146255 2:10398685-10398707 CCCGCCCTTAGATCTGCATCCCG 0: 1
1: 0
2: 1
3: 7
4: 82
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146254_926146271 20 Left 926146254 2:10398684-10398706 CCCCGCCCTTAGATCTGCATCCC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146260_926146271 14 Left 926146260 2:10398690-10398712 CCTTAGATCTGCATCCCGTGGGT 0: 1
1: 0
2: 0
3: 2
4: 46
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146256_926146271 18 Left 926146256 2:10398686-10398708 CCGCCCTTAGATCTGCATCCCGT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146253_926146271 24 Left 926146253 2:10398680-10398702 CCTGCCCCGCCCTTAGATCTGCA 0: 1
1: 0
2: 1
3: 6
4: 134
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146258_926146271 15 Left 926146258 2:10398689-10398711 CCCTTAGATCTGCATCCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146267_926146271 -1 Left 926146267 2:10398705-10398727 CCGTGGGTGGGGTGGGTTTTCCT 0: 1
1: 0
2: 5
3: 40
4: 583
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146250_926146271 30 Left 926146250 2:10398674-10398696 CCGTCCCCTGCCCCGCCCTTAGA 0: 1
1: 0
2: 3
3: 34
4: 458
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146266_926146271 0 Left 926146266 2:10398704-10398726 CCCGTGGGTGGGGTGGGTTTTCC 0: 1
1: 0
2: 0
3: 14
4: 168
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146252_926146271 25 Left 926146252 2:10398679-10398701 CCCTGCCCCGCCCTTAGATCTGC 0: 1
1: 0
2: 1
3: 19
4: 172
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301
926146251_926146271 26 Left 926146251 2:10398678-10398700 CCCCTGCCCCGCCCTTAGATCTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926146271 Original CRISPR TGCCTTCCTCTTCCTGAGGG AGG Intronic
900333725 1:2150388-2150410 TACCTTCCTTCCCCTGAGGGAGG + Intronic
901506194 1:9687537-9687559 TGCCGTCCCCCGCCTGAGGGAGG - Intronic
902399513 1:16150410-16150432 TTGCTTCCCCTTCCTGTGGGGGG - Intronic
902527523 1:17068882-17068904 TGCCTTGCCCTCCCTGAGAGGGG - Exonic
903303032 1:22392419-22392441 TGCCTTCCTCTTTCAAAGAGTGG + Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903606750 1:24580446-24580468 TGTCTTCCTCTTTCTTTGGGTGG + Intronic
903670751 1:25034105-25034127 TGCCTTCCCCTTTCTGAGCCTGG - Intergenic
903755457 1:25657443-25657465 TGCCTTCCTCTTGCAGCCGGAGG + Intronic
904804022 1:33118397-33118419 TGACTCCCACTTCCTCAGGGAGG - Intronic
904896899 1:33824385-33824407 TGCCATCCAGTCCCTGAGGGTGG + Intronic
906254364 1:44336377-44336399 TGCCGTCCCTTTCCTGAAGGTGG + Intronic
908006609 1:59734763-59734785 GGCCTTCCTCTCTCTGTGGGAGG - Intronic
911333785 1:96556414-96556436 TGTTTTCCTCTTCCCTAGGGTGG + Intergenic
912636161 1:111295761-111295783 TGCCTTGCACTTCCTGGGTGAGG - Intronic
912681528 1:111732222-111732244 TGCCTTCTTCTTCCAGAGCTTGG + Intronic
915634153 1:157174584-157174606 TTGGTTCCTCTTCCTGGGGGTGG + Intergenic
916169493 1:161990083-161990105 TGCCTTCAGCTTACTGAGTGAGG - Intronic
916668496 1:166989585-166989607 GGCCTTCCTCTTCCTCTGGCAGG - Intronic
916886927 1:169078593-169078615 AGCCTGCCTCTTCCTGAAGCTGG + Intergenic
919006269 1:191902721-191902743 TGCCAGCCTCTTCCTCTGGGAGG - Intergenic
919790429 1:201286855-201286877 TTCCTTCCCCATCCTCAGGGAGG - Intronic
921902314 1:220463483-220463505 GGCCCTCCACTGCCTGAGGGTGG - Intergenic
922620729 1:226986476-226986498 TGCCATCCTCATCCTGGGGGAGG + Exonic
1062934337 10:1374888-1374910 TGCCTTCCCCTCCCTAAGTGGGG - Intronic
1063185986 10:3652064-3652086 TGCGTTCCACTTCCTGTGGCAGG - Intergenic
1063879296 10:10514536-10514558 TTCCTGGCACTTCCTGAGGGAGG + Intergenic
1064922225 10:20531631-20531653 TCCCTTGCGCTTCCTGAGTGAGG + Intergenic
1066311599 10:34202465-34202487 TGCTTTCCTCTTCCAAAGAGTGG - Intronic
1068127005 10:52852302-52852324 TAACTTCCTCTTCCTGAAGGTGG + Intergenic
1068701335 10:60023284-60023306 TAGCTGCCTCTCCCTGAGGGTGG - Intergenic
1069513277 10:69057674-69057696 TGACTTCCTCCTCCTGGGGAAGG + Intergenic
1069635528 10:69922698-69922720 CGCCTTTCTCTCCCTGGGGGTGG - Exonic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1071805679 10:89118169-89118191 TGCCTTCCTATTACTGCTGGAGG + Intergenic
1072015649 10:91343880-91343902 GGCTTTCCATTTCCTGAGGGTGG - Intergenic
1073107556 10:101040975-101040997 GCCCTTCCTCTTCCAGGGGGTGG - Exonic
1073481148 10:103786861-103786883 TGACTTGCTCCTCCTGAGGCAGG - Intronic
1073570953 10:104580833-104580855 TGGATGCCTCTTCCTGGGGGTGG + Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075625376 10:123960443-123960465 TGGGTTCCTCTTCCTCAGGTGGG - Intergenic
1075894495 10:125983407-125983429 TGCCTTCATCATCATGAGGGAGG - Intronic
1076470360 10:130714212-130714234 TGCCTCCCTCTTGCTGATTGGGG - Intergenic
1076556972 10:131331409-131331431 TGCCTTCCTCTTCCTGGATTTGG + Intergenic
1076770584 10:132661254-132661276 TGCCTTTTTCTTCCTGAAGGAGG - Intronic
1077056967 11:598479-598501 TGTCTTCCTCTTCCGTCGGGCGG - Exonic
1077303836 11:1859042-1859064 TGCCTGCCTCCTCCTGCCGGGGG - Intronic
1078092937 11:8278559-8278581 TAACTTCCCCTTCCTGAGTGTGG + Intergenic
1078139589 11:8682645-8682667 TCGCTTCCTCTTTCTGAGGGTGG - Exonic
1079180897 11:18192634-18192656 CTCCTGCCTTTTCCTGAGGGAGG - Intronic
1079940343 11:26672614-26672636 TTCCTCCCTCTTGTTGAGGGTGG + Intronic
1081370019 11:42289146-42289168 TAGCTCCCTCTTCCTGAGTGCGG + Intergenic
1081728389 11:45349750-45349772 TGCCTTCATCCTCCTGAAGAGGG + Intergenic
1082970469 11:59015429-59015451 CCCCTTGCTCTTCCTGAGTGAGG - Intronic
1083177986 11:60964754-60964776 TGCCTTGTTCTTACTGATGGGGG - Intergenic
1083587656 11:63872221-63872243 AGCTTTCCTCTCCCTGTGGGAGG + Intronic
1083674808 11:64319306-64319328 CCTCTTCCTCCTCCTGAGGGTGG + Intronic
1084350695 11:68597033-68597055 CCACTTCCTCCTCCTGAGGGTGG - Intronic
1084383637 11:68828837-68828859 TTCCTTCTTCCTCCTGGGGGAGG + Intronic
1084762579 11:71283346-71283368 TGCCTCCCCATTCCTGAGGCTGG + Intergenic
1084959282 11:72707802-72707824 TGACTTCCTCTTCCTGATGCAGG - Intronic
1085020505 11:73204049-73204071 AACCTTCCTTCTCCTGAGGGTGG + Intergenic
1086328061 11:85724914-85724936 TTTCTTCCACTTCCTGAGGGAGG + Intronic
1087438030 11:98146959-98146981 TGCCTCCCTTTTTCTAAGGGTGG + Intergenic
1088688269 11:112303471-112303493 TGTCTTGCTCTTCCTGAGTATGG + Intergenic
1091368290 11:135039537-135039559 TGCCAGCCTCTTCCTCAGGAAGG + Intergenic
1091446121 12:545081-545103 TTCCCCTCTCTTCCTGAGGGTGG - Intronic
1091546371 12:1503763-1503785 TGATTTCCTCGGCCTGAGGGAGG + Intergenic
1091663591 12:2402426-2402448 TGCCTGCCTCTTCCAGCTGGTGG - Intronic
1092168095 12:6355269-6355291 TGCCTTCCTCATGCTGATGGAGG + Exonic
1092341788 12:7682930-7682952 CGCCTACCTCTGCCTCAGGGAGG - Intergenic
1092742325 12:11641746-11641768 TGTCTTCCTCTTCTTGAGCTGGG + Intergenic
1094543966 12:31386620-31386642 TTCCTTCCATTTCCCGAGGGGGG + Exonic
1095328234 12:40924132-40924154 GGTATTTCTCTTCCTGAGGGAGG - Intronic
1096931044 12:55210617-55210639 CCCCTTGCACTTCCTGAGGGAGG - Intergenic
1097535457 12:60864464-60864486 TGCATTCTTCTTCATTAGGGTGG + Intergenic
1097877802 12:64659554-64659576 TGTTTTCCTATTGCTGAGGGAGG + Intronic
1101406172 12:104430721-104430743 TTGCTTCCTGTGCCTGAGGGTGG - Intergenic
1104004970 12:124885393-124885415 TTCCTTCCTGTGCCTGGGGGTGG - Intergenic
1104114701 12:125738176-125738198 AGCCTTCCTCTTTCTCAGGTCGG + Intergenic
1104602206 12:130161851-130161873 TGCCCGCATCTTCCTGAGGCTGG - Intergenic
1105326893 13:19378601-19378623 TGACTTTCAATTCCTGAGGGAGG - Intergenic
1105864799 13:24450064-24450086 TGACTTTCAGTTCCTGAGGGAGG + Intronic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1106443413 13:29801132-29801154 TTCCTTCCTCAGCTTGAGGGTGG - Intronic
1106586274 13:31058902-31058924 TGCCCTCCTCTGCCTGACTGTGG + Intergenic
1112371964 13:98802120-98802142 TGCCTTCCTGTTTCTGAGGAAGG + Intronic
1112430630 13:99347327-99347349 TGCCTTTTTTTTCCTGGGGGGGG - Intronic
1114528954 14:23383308-23383330 TGTCTTCCTCTGTCTGGGGGTGG + Exonic
1114534424 14:23413881-23413903 TGGCTTGCTCCTCCTGCGGGAGG + Exonic
1115783730 14:36800989-36801011 TACCTTCATTTTGCTGAGGGTGG + Intronic
1116837303 14:49782047-49782069 TGCCTTCTTCTTCCATAGGTAGG - Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1117814485 14:59582999-59583021 TGCCTCTCTCTTCCTCAGCGGGG - Intergenic
1118246439 14:64115368-64115390 TGCCTTCCTCCCCCTCTGGGTGG - Intronic
1119726290 14:76923703-76923725 AGCCTTCCTTTCTCTGAGGGAGG - Intergenic
1120414730 14:84205381-84205403 GGCCTGCCTCTACCTAAGGGAGG - Intergenic
1120620297 14:86754512-86754534 TGCCTTCCTTTTACTGAAGGTGG + Intergenic
1120938289 14:89919980-89920002 TGACTTTCTCTTCATAAGGGAGG - Intronic
1121337233 14:93084882-93084904 TGCCTTCCTCATCAAGAGGCAGG + Intronic
1122369057 14:101217976-101217998 TGACTTCTGCTTCATGAGGGAGG + Intergenic
1122818588 14:104327992-104328014 TGCCATCCTCCTCTGGAGGGAGG + Intergenic
1122922610 14:104886202-104886224 AGGCTGCCTCTTCCTGAGCGTGG + Intronic
1123755478 15:23394659-23394681 TGCCGTCCTCTTCCTGCAGGAGG + Intergenic
1124363260 15:29054151-29054173 TGCCCTCCTCCTCCTCAGGGAGG - Exonic
1124962613 15:34409914-34409936 TGCCCTCCTCCTCCTCAGGGAGG - Intronic
1124979238 15:34556136-34556158 TGCCCTCCTCCTCCTCAGGGAGG - Intronic
1128228334 15:66018114-66018136 GCCCTTCCTTTTCCTGAGGCTGG - Intronic
1129274428 15:74435697-74435719 TCTCTTCCTCTCACTGAGGGAGG + Intergenic
1129637630 15:77338323-77338345 CACTTTCCTCTTGCTGAGGGAGG + Intronic
1129660199 15:77549072-77549094 TGCGTTCTGCTTCCTAAGGGTGG + Intergenic
1129945111 15:79533030-79533052 TGCATTGCTCTGCCTGAGGGTGG - Intergenic
1130112098 15:80973967-80973989 AGCCTTTCCCTTCCTGAGGAAGG + Intronic
1132367468 15:101267974-101267996 TGCCTTCAGCATCCTGAGAGGGG - Intergenic
1132720225 16:1312081-1312103 TGCCCTCCTCTAAGTGAGGGGGG - Intronic
1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG + Intronic
1134175848 16:12005622-12005644 TGCTGTCCACTTCCTGAGAGAGG + Intronic
1134189879 16:12112842-12112864 TGCCATTCTCTTCCTGCCGGAGG + Intronic
1134460895 16:14428366-14428388 TGCTGTCCTCTTCCTGCAGGAGG - Intergenic
1135138040 16:19899100-19899122 GCCCTCCCTCCTCCTGAGGGTGG + Intergenic
1136016119 16:27402268-27402290 TGCCTGCCTCTCCCTGAGTGTGG + Exonic
1136227208 16:28866923-28866945 TGCCCTCCTCCCCCTGAAGGAGG - Exonic
1136369923 16:29830054-29830076 TGCCTGGCTCCTCCAGAGGGAGG - Intronic
1136997608 16:35201484-35201506 TGGCTACCTCTTCCTGAAAGAGG + Intergenic
1137560134 16:49497102-49497124 TGGCATTCTGTTCCTGAGGGTGG - Intronic
1137885532 16:52098972-52098994 TGTCTTCCTGTAACTGAGGGGGG + Intergenic
1138473559 16:57257459-57257481 TTCCTTACTCTTCCTGATGAGGG - Intronic
1138502585 16:57456921-57456943 TGTCTTCCTCTTCCTGGAAGAGG - Exonic
1138565290 16:57828502-57828524 TGTCATCATCTACCTGAGGGTGG + Intronic
1139339809 16:66261047-66261069 TGCCTTCCTCCTCCTGCAGGAGG - Intergenic
1140544600 16:75794581-75794603 TGGCTTCCTCTTTTTGAGAGTGG - Intergenic
1140854127 16:78962589-78962611 TGCCCTCCTCTTCCTGTGCCAGG - Intronic
1141910668 16:87056557-87056579 TGGCTTCCTCATCATGAGAGTGG - Intergenic
1142003948 16:87680181-87680203 TGGCTTCCTCTGGCGGAGGGAGG + Intronic
1142032921 16:87847344-87847366 TGGTCTCCTCTTCCTGTGGGTGG - Intronic
1142128052 16:88419898-88419920 TGCCCTCCTCTGCCAAAGGGAGG + Intergenic
1143833473 17:9670979-9671001 TGGCTTCCTCTCCCTGGGGAGGG + Intronic
1143919404 17:10318925-10318947 TGCTTGCTTCTTCCTCAGGGTGG + Exonic
1143937401 17:10501245-10501267 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1143939814 17:10528825-10528847 TGCATGCTTCTTCCTCAGGGTGG + Exonic
1144552954 17:16257560-16257582 TGCCCTCCTCTTTCTGGGGCAGG + Intronic
1144872208 17:18378290-18378312 TGCCCTCCTCTGCCAGAGGCTGG + Intronic
1145774853 17:27520748-27520770 TGGCCTCCTTTTCCCGAGGGTGG + Intronic
1145911916 17:28548009-28548031 TGCCTTCCTCCGCCTGAGGCAGG - Exonic
1146000102 17:29125836-29125858 GGCCGCCCTCTTCCTGAGGCTGG - Intronic
1146373724 17:32280916-32280938 TGCTTTCATCTTCCTGGGGGTGG + Intronic
1147213589 17:38886369-38886391 TGCCTTCCTCTGCCTGGGGTTGG + Intronic
1147430316 17:40366831-40366853 TGCCTTCCCCTTCCTGAAAGTGG - Intergenic
1148022467 17:44562521-44562543 AGCCTCGCTCTTCCAGAGGGAGG - Intergenic
1149876287 17:60236754-60236776 TGGTTTCCTGTTGCTGAGGGTGG - Intronic
1149998296 17:61416452-61416474 TGCCTTCTTCCTCCTGAGTTGGG + Intergenic
1150340708 17:64364456-64364478 TGGCCTCATCATCCTGAGGGAGG - Intronic
1150549220 17:66193186-66193208 TGTCCTCCTCCTCCTGAGGCTGG - Intergenic
1151617834 17:75225905-75225927 GGTCTTCCTGTTCCTCAGGGAGG - Intronic
1151621781 17:75250077-75250099 TTCCTTCCCGTTCCTGTGGGCGG - Intronic
1151717113 17:75836540-75836562 TGCCTTCCTCTTCCTCGGTGGGG - Intronic
1152237208 17:79144760-79144782 TGCCTTCCTGTGCCCGAGTGGGG - Intronic
1152494848 17:80663796-80663818 TGCCTTCCTCTGCTTGAGACTGG + Intronic
1152624832 17:81383457-81383479 TCCCTTCCTCTTGGTCAGGGCGG + Intergenic
1155039306 18:22051700-22051722 TTCCTGCCTCTCCCTGGGGGAGG - Intergenic
1157685719 18:49640893-49640915 TGTCTTCCTCTTCCTCCAGGAGG + Intergenic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1159920069 18:74220025-74220047 TGCATCTCTCTCCCTGAGGGAGG - Intergenic
1161194767 19:2980288-2980310 TGGCTTCCTGTTCCTGAGCCTGG - Intronic
1161605333 19:5211793-5211815 AGCCTTCCTCATCCTGATGGTGG - Intronic
1162096338 19:8312065-8312087 AGCCTGAGTCTTCCTGAGGGCGG - Intronic
1163759840 19:19130210-19130232 TGCCTTCCTCTTCCTGCTGCTGG - Exonic
1164106704 19:22113367-22113389 AGCCTTTCTCTTTCTCAGGGAGG + Intergenic
1164432958 19:28204067-28204089 TTCCTTCCCCTTCCTAAGAGAGG - Intergenic
1164525687 19:29011664-29011686 TGCCAGCCTCTTCCTGAAGGCGG + Intergenic
1165824043 19:38695483-38695505 TGCCTTCCTCTTCCTGCCAGGGG + Intronic
1168136814 19:54357365-54357387 TCCCTTCCTCTTGTTGCGGGTGG - Intronic
1168407418 19:56118193-56118215 TGCCTTGCTCTCCCTGATGCTGG + Intronic
1168589461 19:57620574-57620596 TGTCTTCCTCTTACTGTGGATGG - Exonic
925977119 2:9149411-9149433 TGGGTTGCTCTTCCCGAGGGTGG - Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
926610622 2:14942979-14943001 TGCGTTCCCTTTGCTGAGGGAGG - Intergenic
927198478 2:20564166-20564188 TGCTGTCCTCTTCCTCAGGCTGG + Intronic
928115775 2:28544364-28544386 AGCCCTCCTCTCCCTGAGAGAGG - Intronic
929725289 2:44419446-44419468 TTCTTTCCTCTTCCAGATGGGGG - Intronic
930262187 2:49160768-49160790 TGCATTCTTCTTCCAGAGTGAGG + Intergenic
931070998 2:58649857-58649879 TGCCTCCCACTTCCTGAGAAAGG - Intergenic
931460050 2:62442733-62442755 AGCATTCCACTTCCTGAGAGGGG - Intergenic
931994619 2:67828066-67828088 TGCCCTCCCCATCCTGAGTGAGG + Intergenic
932478149 2:72021759-72021781 CCCCTTCCGCTTCCCGAGGGAGG + Intergenic
932495349 2:72143358-72143380 TCCCTTCCTCTTTCGGGGGGGGG + Intronic
933405275 2:81850315-81850337 TGCCTTCCTCTTGGTGTGAGGGG - Intergenic
933902578 2:86860675-86860697 TGCAATCCTCTCCCTGATGGTGG + Intronic
934627084 2:95869714-95869736 CCCCTTCCACTTCCTGAGTGAGG - Intronic
934740161 2:96714779-96714801 TGCCTTACTCTTCCCAAGGCTGG + Intronic
934753300 2:96808445-96808467 TGACTTCCTGTTCCTGGGTGGGG + Intronic
934806477 2:97231573-97231595 CCCCTTCCACTTCCTGAGTGAGG + Intronic
934831031 2:97525605-97525627 CCCCTTCCACTTCCTGAGTGAGG - Intronic
937304587 2:120863346-120863368 TGCTTGCCTCTTCCTGACCGCGG + Intronic
938015662 2:127864934-127864956 TGCCTCCCGCTGACTGAGGGAGG - Exonic
938095234 2:128457130-128457152 TGCCTCCCTCTTGCTGAGCATGG + Intergenic
938945899 2:136211856-136211878 TGACTTCCTCATGCTGTGGGTGG - Intergenic
940707711 2:157125537-157125559 TTCCTTCCCCTGCCTGAGGGAGG - Intergenic
941863326 2:170307952-170307974 TGCCTTCCTATTTCTGAAGTAGG - Intronic
942921300 2:181376572-181376594 TTCCTTCCTGTCCCTGAGGTGGG - Intergenic
944755037 2:202752602-202752624 TGCCCACCTCTTCCTGAAAGAGG + Intronic
944882356 2:204026433-204026455 TGCCACCCCCTTCCTGAAGGGGG + Intergenic
946046726 2:216827494-216827516 TGCCTCCCTCTTCCTTGTGGGGG - Intergenic
946971725 2:225100852-225100874 TGCCTTGCTCTGTCTGAGGAAGG + Intergenic
947065112 2:226216090-226216112 TTCCTTCCTCTTCCTCAAGGGGG + Intergenic
947811181 2:233004785-233004807 TCCCTTCCTCATCCTGCTGGGGG + Intronic
948267097 2:236642985-236643007 TGCCTCCCTCCAGCTGAGGGAGG + Intergenic
948280480 2:236743413-236743435 TGCCTTCCTCGTCCTGGGGAGGG + Intergenic
1169140956 20:3227338-3227360 TGCATTCCACTTCCCCAGGGAGG + Intergenic
1169868717 20:10228740-10228762 TCCCTTCCTCTTTCTCAGAGTGG - Intronic
1170398310 20:15952283-15952305 TGTCAACCTCTTCCTCAGGGTGG + Intronic
1171194556 20:23187092-23187114 AGCCTGGCTCTTCCTGAGGGTGG + Intergenic
1171454179 20:25257851-25257873 TGGCTTCCTCTGCCAGAGGGGGG + Intronic
1172007040 20:31824701-31824723 TGGCTTCAGCTCCCTGAGGGTGG - Intronic
1172227746 20:33316594-33316616 GCCCTGCCACTTCCTGAGGGTGG - Intergenic
1172530828 20:35630327-35630349 TGCCTTCATTGTCCAGAGGGTGG - Intronic
1173553655 20:43950400-43950422 TGGCTTCCTCTTTCTGGGGAGGG + Intronic
1173672472 20:44808552-44808574 TGCCTTCATGTAGCTGAGGGAGG - Intronic
1175105410 20:56611332-56611354 GGCCTTCCCTTTCCTGTGGGAGG + Intergenic
1175417297 20:58810310-58810332 TGGCTTCCTGTTCCTGTGGTGGG + Intergenic
1175466820 20:59194872-59194894 TGCTTGCTTGTTCCTGAGGGAGG + Intronic
1175907492 20:62388044-62388066 CGCCTGCCGCTTCTTGAGGGTGG + Intronic
1176364311 21:6023405-6023427 GCCATTCCTCTTCCTGGGGGTGG + Intergenic
1176375396 21:6084583-6084605 TGCCTTCTACTTGGTGAGGGCGG + Intergenic
1179087942 21:38237061-38237083 TCCCTTCCTCTTGCTGCTGGTGG - Intronic
1179588716 21:42390815-42390837 TGCCTTCATCTTCATGAGGCTGG - Intronic
1179748078 21:43453661-43453683 TGCCTTCTACTTGGTGAGGGCGG - Intergenic
1179759207 21:43515140-43515162 GCCATTCCTCTTCCTGGGGGTGG - Intergenic
1180048137 21:45319046-45319068 TGTCTCCCTCTGCCTGAGGAGGG - Intergenic
1180571280 22:16723164-16723186 TGCCTTCCATTTCCTGAATGTGG + Intergenic
1180700869 22:17780880-17780902 TTCCATGCTCTTCTTGAGGGTGG + Intergenic
1180980837 22:19877296-19877318 GGCCCTCCTCTTCCCGGGGGTGG - Intronic
1181725070 22:24806003-24806025 TCCCTCCCTCTTCCCTAGGGCGG - Intergenic
1181892591 22:26076839-26076861 TCCTTTCCTTTTCCTGAGGCTGG - Intergenic
1182360632 22:29744524-29744546 TGCCTGCCTTTCCCTGAGGTGGG + Intronic
1182480778 22:30607346-30607368 GGCCTTCCTCTTCCTTCTGGGGG + Exonic
1182542058 22:31048932-31048954 TGCCTTCCCCTCCCTGGGTGGGG - Intergenic
1182680347 22:32074530-32074552 AGGCTTCAGCTTCCTGAGGGAGG - Intronic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
1185212810 22:49581349-49581371 TGCCTTCCTCTTCCTTACTAGGG + Intronic
1185405016 22:50642700-50642722 TGCCTTCCTCTCCCTGCCAGTGG - Intergenic
949803452 3:7928563-7928585 TCGCTTTCTCTTCCTGAGTGTGG - Intergenic
950833340 3:15896800-15896822 TCCCTTCCTCTTAGTGTGGGTGG + Intergenic
953383693 3:42492802-42492824 TGCAGTCCCCTTCCTGAGGTGGG - Intronic
955864860 3:63371878-63371900 TTCCTTCCCCATCCTGAGGGTGG - Intronic
956786475 3:72647017-72647039 TGCCTACCTCATCCTCATGGGGG - Intergenic
957632622 3:82737135-82737157 TCCCTTCCTCTGCCTGAGTGAGG + Intergenic
958453839 3:94306012-94306034 TGCCTTCATCTTCCAGAGTCCGG + Intergenic
959581922 3:107991342-107991364 TGACCTCCTCTTCCTGAGCCAGG + Intergenic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
961018724 3:123486466-123486488 AACATTCCTCTTCCTTAGGGAGG - Intergenic
962219454 3:133551526-133551548 TCCCTTGCGCTTCCTGAGTGAGG - Intergenic
965057259 3:163737647-163737669 TCCCTACCTCTTCCTGAAGTTGG + Intergenic
965514081 3:169601998-169602020 TGGGTTCCTCTTCTTGAAGGGGG - Intronic
966852710 3:184174680-184174702 CGCCTACCCCTTCCTGAGGCGGG + Intronic
967134536 3:186502322-186502344 TGCCATCCTTTGCCTGGGGGAGG + Intergenic
968936612 4:3614399-3614421 CGCATTCCTCCTTCTGAGGGAGG - Intergenic
970010617 4:11454859-11454881 TTCCTTCTTCTTCTTGAGGCAGG - Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
977234073 4:94485993-94486015 CGCCTTCCTGATCGTGAGGGGGG - Intronic
979300411 4:119080363-119080385 TGGCTTTCTTTTCCTGAGTGGGG - Intergenic
979706020 4:123721577-123721599 TCCCTTGCACTTCCTGAGTGAGG - Intergenic
981139204 4:141248910-141248932 TCTCTTCCTCTTCTTGTGGGTGG - Intergenic
982176966 4:152715056-152715078 GGCCTGCATCTTCCTGATGGTGG - Intronic
982836568 4:160126023-160126045 CCCCTTGCTCTTCCTGAGTGAGG + Intergenic
985786444 5:1897813-1897835 TGCCTGCCTGTGCCTGAGGGAGG + Intergenic
985879956 5:2631194-2631216 TGTCTTCCTCTTCATGAAGTAGG + Intergenic
986070541 5:4278520-4278542 TGGCATCCTCCTCCTGAGCGTGG + Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
989981355 5:50649392-50649414 TGGCTTCCTTTTTCTGAGTGAGG + Intergenic
990179146 5:53141259-53141281 TCCCTTGCACTTCCTGAGTGTGG - Intergenic
994968427 5:106703779-106703801 TGGCTCCCTCTTCCTGGGGGAGG + Intergenic
996977023 5:129447281-129447303 TGCCTTCCCCTTCCACAGGCTGG + Intergenic
997092187 5:130871026-130871048 TCCCAGCTTCTTCCTGAGGGAGG + Intergenic
997507550 5:134430105-134430127 TGCCTTCTTCCTCCTGAGAGGGG - Intergenic
998737128 5:145155069-145155091 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
999372714 5:151065608-151065630 TCCCTTCCCCTCTCTGAGGGAGG + Intronic
1000393737 5:160751089-160751111 TGCCTTTCTCTTCCAGACGGAGG + Intronic
1001147813 5:169200151-169200173 CCCCTTCCCTTTCCTGAGGGAGG - Intronic
1003342253 6:5233145-5233167 TGCCTCCCATTTCCTGAGAGAGG + Intronic
1004055397 6:12132188-12132210 TTCCTTCCTGGTCCTGAGGGAGG + Intronic
1004205841 6:13591571-13591593 TGCCTGTCTCTGCCTTAGGGAGG + Intronic
1004369914 6:15043542-15043564 TCCCTTCCTGCACCTGAGGGTGG - Intergenic
1005364937 6:25067205-25067227 TGTCTTCCTCTACGTGAGGCAGG - Intergenic
1005819166 6:29582875-29582897 CTCCTTCCTCTTCTTCAGGGTGG - Intronic
1006188226 6:32192226-32192248 AGCCTTCCTCATCCTGAGGGGGG + Exonic
1006874055 6:37280055-37280077 TCTTTTCCTGTTCCTGAGGGAGG + Intronic
1007252307 6:40504096-40504118 TGCATTGGTCTTTCTGAGGGAGG - Intronic
1007479082 6:42138096-42138118 TGACTTCCTGTGCCTGAGGTGGG + Intronic
1007704351 6:43781736-43781758 TGCCCGCCTCTTCCTGCGGCAGG + Intronic
1007799591 6:44380874-44380896 GGCCTCCCCATTCCTGAGGGTGG - Intergenic
1008275845 6:49543434-49543456 TTACTTCCTCTTCCTGAAGGAGG - Intergenic
1009946547 6:70347529-70347551 TTCCTTCCTTAGCCTGAGGGTGG + Intergenic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1010653330 6:78480431-78480453 TGCCTTCCTCTTATGGAGGGTGG - Intergenic
1011364762 6:86569765-86569787 TCCCTTGCACTTCCTGAGTGAGG - Intergenic
1012104240 6:95133769-95133791 TACTTTCCTCTGCCTGTGGGTGG - Intergenic
1012923505 6:105244565-105244587 TGCCTTGCACTTCCCGAGTGAGG - Intergenic
1013180051 6:107709551-107709573 TTCCTTCCTCTGCCTGTGGCTGG + Intronic
1017945879 6:159095887-159095909 TGCCAGGCTCTTCCTGAGGGCGG + Intergenic
1019062339 6:169265479-169265501 TGCCCTCCTCCTCCTGAAGCTGG + Intergenic
1019464811 7:1181745-1181767 TTCCTGCCTCTTCCTGATCGTGG - Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1019794385 7:3038997-3039019 TGCCAGCCTCTTCCTGTGGCAGG - Intronic
1019809974 7:3158131-3158153 TGCCTACCTCGTCCTGCGGATGG + Exonic
1023294059 7:38696950-38696972 TGCCTTCCTCTCCCTGATGCTGG - Intergenic
1023301735 7:38780376-38780398 AGCCTTCCTCCTCCTGATGGAGG + Intronic
1023708488 7:42967072-42967094 TTCCTTCCTCCTCCTTTGGGAGG + Intergenic
1023921892 7:44636283-44636305 GGGCTTCCTATTTCTGAGGGTGG - Intronic
1023970592 7:44987867-44987889 TGCTTTCCTCTGCCTGGGGGTGG - Intergenic
1024628036 7:51225163-51225185 TGGCTTCCTCTGCCTGTGAGTGG + Intronic
1024677695 7:51652217-51652239 GCCCTTCATCTTCCTGAGTGAGG - Intergenic
1024852999 7:53743697-53743719 TCATTTCCTCGTCCTGAGGGTGG - Intergenic
1025590872 7:62859099-62859121 TCCCTTGCACTTCCTGAGTGAGG - Intergenic
1025797929 7:64757383-64757405 TGCCGTCCCCTTCCACAGGGTGG - Intergenic
1028604865 7:92644670-92644692 TTCCTTCCTCTTTTTCAGGGTGG - Intronic
1031256336 7:119454338-119454360 TGCTTTCATCTTCCTGTGGGAGG + Intergenic
1031969137 7:128051225-128051247 TGCCTTTGTCTTCGGGAGGGTGG - Intronic
1034905371 7:154940212-154940234 TGCCTTCCTCTTCCACTGTGAGG + Intronic
1034938400 7:155214384-155214406 TGCCGTTCTCTTCCTGGGGCTGG - Intergenic
1035868700 8:3113111-3113133 TGCCTTCCTTTCCCTGAAGGCGG + Intronic
1036988441 8:13564698-13564720 TGACTTCCTCTTTCTGGGGTTGG + Intergenic
1037325684 8:17687715-17687737 GGCCTTCGTTTTCCTGATGGAGG - Intronic
1037463970 8:19140885-19140907 TCACTTCCTCTTCCTCACGGGGG + Intergenic
1037618653 8:20543794-20543816 TGCATTCCTCTCCTTGACGGCGG + Intergenic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1038456015 8:27672401-27672423 TCCCTTGCTCTCCCTGAGGCTGG + Exonic
1040447761 8:47512659-47512681 TGCATTCCTCTTCCTGGCAGTGG + Intronic
1040554021 8:48463155-48463177 TCCCTTGCACTTCCTGAGTGAGG + Intergenic
1041689189 8:60672639-60672661 TGCCGTCCTCTACCACAGGGCGG + Intergenic
1042272227 8:66966275-66966297 TCCCTTCCTGTTCCTAAGGGTGG + Intronic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1042689538 8:71482923-71482945 TTCCTTCTTCTTCCTGGTGGTGG + Intronic
1042868169 8:73373837-73373859 TGCCTTCCTGTTGCTGAGCATGG - Intergenic
1047046305 8:121056624-121056646 CCCCTTGCTCTTCCTGAGTGAGG + Intergenic
1050299890 9:4247091-4247113 TGCCTTGGTCTTCCTGAGTTCGG + Intronic
1050766742 9:9143744-9143766 AGCCTTCCTCTCTCTGAGGATGG - Intronic
1051684897 9:19647941-19647963 TTCCTTCCTCTTCCTATTGGTGG + Intronic
1052718779 9:32149265-32149287 TCCCTTGCGCTTCCTGAGTGAGG - Intergenic
1052997441 9:34558781-34558803 GGCCTTCCTATTCCAGAGTGAGG - Intronic
1058619295 9:106865245-106865267 TGCCTTGCCTTTCCTGAAGGAGG - Intronic
1061732844 9:132629837-132629859 TGGGTTCATCTTCCTGGGGGAGG + Intronic
1062538926 9:137032934-137032956 TCCCTTCCTCTTCCTGGAGCGGG - Exonic
1185990528 X:4889928-4889950 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
1186345201 X:8684846-8684868 TGGCTTCCGCTTGCTGAGGAAGG - Intronic
1187821883 X:23296662-23296684 TGCCTTCCTTTTCCTGGAAGTGG + Intergenic
1188812750 X:34672074-34672096 TTCCTTCTTTTTCATGAGGGAGG - Intergenic
1190046637 X:47116598-47116620 TGTCTTCCTTTTAGTGAGGGTGG - Intergenic
1191105721 X:56770901-56770923 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1191106714 X:56776303-56776325 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1195626278 X:107008088-107008110 TGCCTCCCTCTTCTTGGGTGGGG - Intergenic
1195914213 X:109920093-109920115 GGCCTTCCATTTCCTGAGCGTGG + Intergenic
1196282297 X:113836133-113836155 TGCATTTCTCTTACTGAGTGTGG + Intergenic
1197917567 X:131552878-131552900 CCCCTTCCACTTCCTGAGTGAGG - Intergenic
1198544032 X:137672293-137672315 TCCCTTGCTCTTCCCGAGTGAGG - Intergenic
1198597723 X:138255155-138255177 TGAATTCCTTTTCCTGAAGGTGG + Intergenic
1199711563 X:150473315-150473337 TGCCTCCCTCTTCTGGAGAGTGG + Intronic
1202604915 Y:26630998-26631020 TGACTTTCAATTCCTGAGGGAGG + Intergenic