ID: 926146474

View in Genome Browser
Species Human (GRCh38)
Location 2:10399641-10399663
Sequence GGCCAATGGTGTGAATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926146474_926146479 -4 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146479 2:10399660-10399682 GGCCGTGGATGTTGTGGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 135
926146474_926146476 -10 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146476 2:10399654-10399676 ACCATTGGCCGTGGATGTTGTGG 0: 1
1: 0
2: 0
3: 1
4: 68
926146474_926146478 -9 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146478 2:10399655-10399677 CCATTGGCCGTGGATGTTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 60
926146474_926146481 2 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146481 2:10399666-10399688 GGATGTTGTGGGTCAGGTGATGG 0: 1
1: 0
2: 0
3: 29
4: 305
926146474_926146482 3 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146482 2:10399667-10399689 GATGTTGTGGGTCAGGTGATGGG 0: 1
1: 0
2: 0
3: 18
4: 214
926146474_926146485 14 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146485 2:10399678-10399700 TCAGGTGATGGGCACTGGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 234
926146474_926146484 13 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146484 2:10399677-10399699 GTCAGGTGATGGGCACTGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 224
926146474_926146483 9 Left 926146474 2:10399641-10399663 CCAGCACATTCACACCATTGGCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 926146483 2:10399673-10399695 GTGGGTCAGGTGATGGGCACTGG 0: 1
1: 0
2: 3
3: 25
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926146474 Original CRISPR GGCCAATGGTGTGAATGTGC TGG (reversed) Intronic
905099391 1:35505419-35505441 GGCAAGTGGTGTGTATGTGCAGG - Intronic
905442291 1:38003419-38003441 GGCCTATGCTGAGAATGTCCAGG - Intronic
905447970 1:38039588-38039610 GTCCACTGGTGTGTATGTGTTGG + Intergenic
905893056 1:41529002-41529024 GGTCAGTGGTGTGAGTGTGAGGG - Intronic
906865437 1:49413352-49413374 GGTCTATAGTGTGTATGTGCAGG + Intronic
908251073 1:62266290-62266312 AGGCAGTGGTGTGAGTGTGCAGG - Intronic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
908760075 1:67503583-67503605 GGCCAAGGGTGGGAATGTCATGG + Intergenic
910269574 1:85379293-85379315 GGCCGATGCTGTGGATGTGATGG - Intronic
910445662 1:87296977-87296999 GGCCCATGGTGGGAAAGTACAGG - Intergenic
911355104 1:96807537-96807559 AATCACTGGTGTGAATGTGCAGG - Intronic
912392557 1:109314320-109314342 GGCCAATGGTGTGGATGGTGTGG - Exonic
912572611 1:110635525-110635547 GGACAATGATGGGAAAGTGCTGG + Intergenic
915751242 1:158212936-158212958 GGCCAATGGTGTACATGCTCAGG + Intergenic
916079434 1:161223306-161223328 GGCCAAAAGGGAGAATGTGCTGG - Intronic
918684350 1:187396822-187396844 GGGCACTGGAGTGAATGTCCTGG - Intergenic
918802399 1:188987720-188987742 GGCCATTGGTGAGATTATGCTGG - Intergenic
921515119 1:216081264-216081286 AGCCAATGGTGTCAATGCGTTGG + Intronic
922320494 1:224482323-224482345 GACCACAGCTGTGAATGTGCGGG + Intronic
922516842 1:226214325-226214347 GGAGAATGGTGTGAATGCGGGGG - Intergenic
923029101 1:230233105-230233127 GGCCATTGCTGTGAAATTGCTGG + Intronic
1066046013 10:31596158-31596180 GGCCACAGAAGTGAATGTGCTGG + Intergenic
1080340678 11:31259957-31259979 GGCTACTGTTGTGAATGTGCTGG + Intronic
1083032886 11:59610390-59610412 GGCCAAAGCTGTGAAGATGCTGG - Exonic
1085304225 11:75476118-75476140 AGCCACTGGTGTGAATGGGGTGG - Intronic
1085328854 11:75630095-75630117 AGACAATGGTGTGAAGGTGGTGG - Intronic
1085876540 11:80413741-80413763 GGCATATAGTGTGTATGTGCTGG - Intergenic
1086496084 11:87405828-87405850 GGCCAATGGTATGAAAGTGCTGG - Intergenic
1088396871 11:109378705-109378727 GGCCCATGGAGTGAAAATGCGGG + Intergenic
1089291317 11:117439371-117439393 TGCCATTGGTGTGGATGAGCCGG + Exonic
1089533666 11:119148359-119148381 GGGCAAGGGAGAGAATGTGCAGG + Intergenic
1089749865 11:120643376-120643398 GCCCCAAGGTGGGAATGTGCAGG + Intronic
1090742435 11:129677094-129677116 GGAGAATGGTGTGAATCTGCAGG + Intergenic
1091890671 12:4051730-4051752 GGCCAATGCTGTGGTTGTGGTGG + Intergenic
1096187124 12:49588515-49588537 GGCCACTGGGGCGGATGTGCCGG + Exonic
1096194799 12:49642938-49642960 GGCCTTTGGTGTGGAGGTGCTGG - Exonic
1096982830 12:55738177-55738199 GGCCATTGTGGTGAAGGTGCAGG + Intergenic
1097274372 12:57802255-57802277 GGCCGCTGGGGTGAGTGTGCAGG + Exonic
1097888734 12:64756415-64756437 GACCTATGGTGTGATTATGCTGG + Intronic
1098704066 12:73665113-73665135 GGCCATTGGTGAGTGTGTGCTGG - Intergenic
1099587977 12:84545943-84545965 GGCCCATGGTTGGCATGTGCAGG + Intergenic
1103082161 12:118033526-118033548 TAACAATGGTGTGCATGTGCAGG - Intronic
1103458740 12:121087385-121087407 GGCTCATGGTGTGAAGGTGCTGG - Intergenic
1106396768 13:29387946-29387968 GCCCAATTGTGTATATGTGCTGG - Intronic
1108423309 13:50272433-50272455 GGCCAGAGGTGTGAATTTGGGGG + Intronic
1112353648 13:98656793-98656815 AGCCATTGCTGTGAATCTGCTGG + Intergenic
1113457807 13:110461406-110461428 GCCCAATGGTGCAGATGTGCAGG - Intronic
1113801649 13:113089721-113089743 GGGCAAAGGTGGGTATGTGCAGG + Exonic
1119723109 14:76904697-76904719 TTCCCATGGTGTGAATGTCCTGG - Intergenic
1120843737 14:89108570-89108592 TGGCAATGGTGTGTATGGGCGGG - Intergenic
1121210178 14:92202561-92202583 TGCCAATGGGTTGGATGTGCAGG + Intergenic
1124161731 15:27276348-27276370 TGCCAATGGTGCAAATGTGGTGG + Intronic
1126334786 15:47575389-47575411 GCACAATGGTGGGAAGGTGCAGG + Intronic
1127651276 15:61010518-61010540 GGCCAATTGTATGAATGCACAGG + Intronic
1129030628 15:72615292-72615314 CACCAAAGCTGTGAATGTGCTGG + Intergenic
1130163395 15:81425299-81425321 GGAGAATGGCGTGAATGTGGGGG + Intergenic
1133706990 16:8364136-8364158 GGAGAATGGCGTGAATGTGGGGG + Intergenic
1134106209 16:11487282-11487304 GGCCCATGGTGTGGATGGTCAGG + Exonic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1143026221 17:3943501-3943523 GGCCAAGGGTGTGTATGAGAAGG - Exonic
1144633473 17:16888195-16888217 GGCTAATGGAGAGAATGTGTGGG - Intergenic
1144704482 17:17358216-17358238 GGCCAATGGTGGGAGGGGGCTGG + Intergenic
1149514910 17:57273699-57273721 GGCTAATGCTGTGAATGCACAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1151473011 17:74329655-74329677 GGCAAGAGGTGTGAATGGGCTGG + Intronic
1161256637 19:3313561-3313583 GGTCACTGGTGTGTATGTGGGGG - Intergenic
1161568925 19:5019370-5019392 GGACATTGGTGTGCAGGTGCTGG + Intronic
1161568993 19:5019767-5019789 GGACAGTGGTGTGCAGGTGCTGG + Intronic
1163084749 19:14971393-14971415 GGGCTATGGTATGGATGTGCAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164889587 19:31812041-31812063 GGCTGATGGTGGGAATGTGTGGG + Intergenic
1165175763 19:33928756-33928778 GTGCAGTTGTGTGAATGTGCAGG + Intergenic
1165686830 19:37829150-37829172 GGACAGTGATGAGAATGTGCAGG - Intergenic
1166559074 19:43720022-43720044 GGCCGATGTGGTGAATGTGAGGG + Intergenic
925800677 2:7597251-7597273 GTCCTATGATTTGAATGTGCTGG + Intergenic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
931607335 2:64065535-64065557 GGCTAATGGGATGAATGGGCTGG + Intergenic
931789222 2:65648570-65648592 GGCGCATGGTATGTATGTGCAGG - Intergenic
937916359 2:127100980-127101002 GCCCAAGGGTAGGAATGTGCGGG + Intronic
938180217 2:129175740-129175762 AGAAAATGGTGTGCATGTGCTGG + Intergenic
939089078 2:137757723-137757745 TGCCACTAGTGTAAATGTGCAGG + Intergenic
942563324 2:177243381-177243403 GCCTTACGGTGTGAATGTGCTGG - Intronic
944389774 2:199205756-199205778 GAGCAACGGTGTGAATGTGTGGG - Intergenic
945459008 2:210082754-210082776 TGAGAATGGTGTGAATGTGGGGG - Intronic
946282706 2:218677879-218677901 GGAGAATGGTGTGAATCTGGAGG - Intronic
946364896 2:219243027-219243049 GGCCAAGGGTGGGAAAGGGCAGG - Intronic
947254474 2:228146573-228146595 AGCCAATGGTGTTAATTTGAGGG - Intronic
948325811 2:237119807-237119829 GCCACATGGTTTGAATGTGCAGG - Intergenic
1168904774 20:1394305-1394327 GGCCAATTGTGTGTATGTGTTGG + Intergenic
1173975081 20:47180815-47180837 GCCCAACTGTGTCAATGTGCTGG + Exonic
1177016510 21:15795745-15795767 AGGCAATTGTCTGAATGTGCTGG + Intronic
1177282695 21:19004219-19004241 GGCCAATGATCTGAATGAGCTGG + Intergenic
1178970051 21:37166251-37166273 GGCCAAGGGTGTATATATGCTGG - Exonic
1180248613 21:46564758-46564780 GGACAAGGGTGTGAGCGTGCGGG + Intronic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1182087885 22:27573898-27573920 GGTTAATGTTATGAATGTGCCGG - Intergenic
1182712365 22:32330921-32330943 GGCCTCTGGTGTGTATGTGTTGG + Intergenic
1184592077 22:45491637-45491659 GGCCAGTGGTGGGAAGGAGCAGG - Intergenic
951656000 3:25009224-25009246 GGCCATGGGTGTGAGTGTGAAGG + Intergenic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
957346038 3:78962731-78962753 GGACAATGGTGTGAACCTGGAGG + Intronic
958483788 3:94677340-94677362 GGAGAATGGCGTGAATGTGCCGG + Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964409978 3:156387775-156387797 TGAAAATGGTGTGAATGAGCGGG + Intronic
965373341 3:167891585-167891607 GGCCAATAGTGTAACTGTCCAGG + Intergenic
969139434 4:5055700-5055722 GGGCTATGGTGTGAGGGTGCAGG - Intronic
969234324 4:5854743-5854765 GCCCAATGGTGCAAAGGTGCAGG + Intronic
972606938 4:40622384-40622406 GCCCTGTGGTATGAATGTGCTGG + Intronic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
976635406 4:87282130-87282152 TGCCAATGATATGAATGGGCTGG - Intergenic
976741954 4:88365570-88365592 GGACAATGGTGTGAACCTGGAGG - Intergenic
978333703 4:107643625-107643647 GGCCTATGATGTTAATGTGAGGG + Intronic
987969845 5:24928548-24928570 AGGCAGTGGTGTGAATATGCTGG + Intergenic
990840787 5:60077339-60077361 GGCCATTGGTGAGTATGTGAAGG + Intronic
992144591 5:73833047-73833069 AGCAGATGGTTTGAATGTGCTGG + Intronic
992886375 5:81164295-81164317 AACCCATGGAGTGAATGTGCAGG - Intronic
996770471 5:127080352-127080374 GGTCAATGGTGTGAGGGTGGAGG + Intergenic
999379152 5:151108298-151108320 TGCCAAATGTGTGATTGTGCAGG - Intronic
999569429 5:152901933-152901955 GGCCAATGCAGGGAATGTGTTGG - Intergenic
1002762132 6:210328-210350 GGCCAATGGTCTGAGGGTGTGGG - Intergenic
1002781886 6:373241-373263 GGACAATGGAGTGAAGGTGGTGG + Intergenic
1004521398 6:16364392-16364414 GGAGAATGGTGTGAACGTGGAGG - Intronic
1007469062 6:42076497-42076519 TACCAATGATGTGCATGTGCTGG + Intronic
1007904274 6:45443461-45443483 CACCAATGGTGTGAATGTTGGGG + Intronic
1012260437 6:97081863-97081885 GGCACATGGTGTGAATGTGTAGG + Intronic
1015751221 6:136561199-136561221 GGCCAATTGTATGTATGTTCAGG - Intronic
1019138724 6:169929556-169929578 GGCCAACAGTGAGAATGTGGAGG + Intergenic
1023039228 7:36157619-36157641 GGCCAAGAGTGAGAATGTGACGG - Intronic
1023057773 7:36303558-36303580 GGCCAGTGGTGTGACACTGCAGG + Intergenic
1023678817 7:42661818-42661840 GAGCATTGGTGTGAATGTGGAGG + Intergenic
1025131283 7:56375377-56375399 GGCCGATGGTGGGCCTGTGCAGG + Intergenic
1026145869 7:67746061-67746083 GGCCCATGGGCAGAATGTGCAGG + Intergenic
1028067248 7:86402162-86402184 TGCTAATGGTGTGATTGTGAAGG - Intergenic
1029674945 7:102062140-102062162 GGCCAATGGTATGTAAGTGATGG - Intronic
1030610496 7:111683645-111683667 ATCCAATTGTGTGAAGGTGCTGG + Intergenic
1031052404 7:116956970-116956992 GGACAAAGTTGTGAAAGTGCAGG + Intronic
1032444614 7:131971550-131971572 GATCATTAGTGTGAATGTGCTGG - Intergenic
1033290659 7:140080066-140080088 GATCAATTGTGTGAATGAGCTGG - Intergenic
1033615030 7:143005710-143005732 GGCCAATGCTGTGTACGTTCAGG + Intergenic
1034806048 7:154090284-154090306 GGCTCATTGTGTGAATTTGCAGG - Intronic
1038452216 8:27646980-27647002 GGGCAATAGTGTGTGTGTGCGGG - Intronic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1040532580 8:48277457-48277479 TGGCCATGGTGTGAATGTCCTGG + Intergenic
1042364199 8:67917672-67917694 GGCCAGTGGTGACAATGTGGTGG - Intergenic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1045809948 8:106209781-106209803 GGCCAAAGGAGTGCATGAGCAGG + Intergenic
1048267279 8:132998675-132998697 GGGCTAAAGTGTGAATGTGCTGG + Intronic
1048284505 8:133131211-133131233 GTCCAGTGGTGTGAATGGCCTGG - Intronic
1049495707 8:142931227-142931249 GGCCACTGGTGTAAAAGTCCTGG + Intergenic
1052159331 9:25235604-25235626 TGCCAGAGGTGTGAAGGTGCCGG - Intergenic
1052835193 9:33245292-33245314 GGCTAATGTGGGGAATGTGCAGG - Intronic
1055174552 9:73300749-73300771 GGCCAAAGGAGAGATTGTGCAGG + Intergenic
1055388287 9:75788590-75788612 TGCCAATGGTGGGCATGTGCAGG - Intergenic
1061552633 9:131346719-131346741 GGGCAATGTTGGGAATGTGATGG - Intergenic
1185457360 X:317785-317807 GGCCTATGGGGTAAAAGTGCGGG - Intronic
1187896647 X:23988115-23988137 TGGCCATGGTGTGACTGTGCTGG - Exonic
1189338957 X:40189788-40189810 GACTAATGGTGTGATTATGCTGG - Intergenic
1195893576 X:109722057-109722079 AGACAATGGTGTTAATGTGAAGG - Intronic
1199322147 X:146452724-146452746 TGCTAGTGGTGAGAATGTGCAGG + Intergenic
1200121352 X:153792486-153792508 GGCCAGTGGGGTGAAGGGGCAGG - Intronic
1200830797 Y:7687523-7687545 GCCCAATGGCCTGAATGTTCTGG + Intergenic