ID: 926148438

View in Genome Browser
Species Human (GRCh38)
Location 2:10411270-10411292
Sequence CAGGACAATGGGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 580}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926148431_926148438 -9 Left 926148431 2:10411256-10411278 CCCAGAGGAGGTTACAGGACAAT 0: 1
1: 0
2: 2
3: 16
4: 135
Right 926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG 0: 1
1: 0
2: 4
3: 61
4: 580
926148422_926148438 27 Left 926148422 2:10411220-10411242 CCTCCACGGCTGCTTATGGTCTT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG 0: 1
1: 0
2: 4
3: 61
4: 580
926148432_926148438 -10 Left 926148432 2:10411257-10411279 CCAGAGGAGGTTACAGGACAATG 0: 1
1: 0
2: 0
3: 14
4: 159
Right 926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG 0: 1
1: 0
2: 4
3: 61
4: 580
926148424_926148438 24 Left 926148424 2:10411223-10411245 CCACGGCTGCTTATGGTCTTGGC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG 0: 1
1: 0
2: 4
3: 61
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926148438 Original CRISPR CAGGACAATGGGAAGGAGGT GGG Intronic
900469094 1:2843112-2843134 CAGGGTGATGGGAAGAAGGTTGG + Intergenic
900860196 1:5223398-5223420 CAGGACACAGGGAGGGAGGGAGG + Intergenic
901741560 1:11345299-11345321 GAGGCCACGGGGAAGGAGGTGGG + Intergenic
902626076 1:17677083-17677105 CAGGACCAAGGAAAGGAGATGGG + Intronic
903087487 1:20875663-20875685 CAGCACTCTGGGAAGGAGGCAGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903895766 1:26602959-26602981 GAGGACTGTGGGGAGGAGGTGGG - Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904404193 1:30275390-30275412 GAGGACAAGTGGAGGGAGGTGGG - Intergenic
904625795 1:31801320-31801342 CAAGAAAAGAGGAAGGAGGTGGG - Intronic
904983177 1:34523763-34523785 CAGGGCAATGGGTAGGGGGGAGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905172935 1:36119688-36119710 CAGCACAGTGGGAAGGAAGGAGG + Intronic
905178784 1:36154384-36154406 CAAGACAAGGGGTGGGAGGTGGG + Intronic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905902256 1:41589388-41589410 CAGCCCAATAGGAAGGAGATCGG + Intronic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
907097007 1:51791188-51791210 CAGGAAACTGGGCTGGAGGTGGG - Intronic
907332667 1:53681412-53681434 CAGGACAATGCCAAGTAGGGAGG + Intronic
907638234 1:56157966-56157988 CAGGTGCATGGGCAGGAGGTGGG + Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
909361784 1:74768154-74768176 CAGGACAATGGGTAGCTGTTTGG + Intergenic
909570122 1:77100644-77100666 CAGGGCATAGGGAAAGAGGTGGG + Intronic
910207126 1:84759310-84759332 CAGGGCCACGGGAAGGAGGTGGG - Intergenic
910424303 1:87103429-87103451 CAGGAATGTGGGAAGCAGGTGGG + Exonic
911040277 1:93585716-93585738 CAGGGCAATTGCAAGGAGGGAGG - Intronic
911064974 1:93780007-93780029 GAGGTCAGTGGGAAGGAGGTTGG - Intronic
912756665 1:112329918-112329940 CAGGGCAATGGGATGAAGTTTGG - Intergenic
913454737 1:119019389-119019411 CAGGACACTGGGCAAGAGCTCGG + Intergenic
913598539 1:120401459-120401481 CAAGAGGATGGGAAGGAGATAGG + Intergenic
915531534 1:156505049-156505071 CAGGAGAGTGGGCAGGATGTGGG + Intergenic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915721019 1:157985711-157985733 CTGAACAATAGGATGGAGGTTGG + Intergenic
915725524 1:158014426-158014448 CCGGACAATGGGCAGGAGTATGG - Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916511179 1:165473659-165473681 GAGAACCATGGGCAGGAGGTTGG - Intergenic
916523930 1:165591452-165591474 CAGTACTTTGGGAAGGAGGTGGG - Intergenic
916646583 1:166792599-166792621 CAGGAAAATGGGATGGAGCCAGG + Intergenic
916961949 1:169897345-169897367 GAGGACACTGGGAAGAGGGTGGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917489439 1:175485435-175485457 CAGGACATTGGCAAGGAGAAAGG + Intronic
917588600 1:176454007-176454029 CAGGACATTGGGAAGGGTGGTGG + Intergenic
918528016 1:185486281-185486303 TAGGAAAATGGGAGGGAGGAAGG + Intergenic
919086626 1:192928543-192928565 CAGGGCAACGGAAGGGAGGTTGG + Intergenic
919104620 1:193133612-193133634 CAAGTCAATGGGAGGAAGGTGGG + Intronic
919435074 1:197548288-197548310 CAGTTCAATGAGAAGGAAGTGGG + Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920341191 1:205276171-205276193 CAGGACCATGGGCTGGAGGCGGG - Intergenic
920539136 1:206764307-206764329 CAGGGCAAAGGGGAGGAGTTGGG - Intergenic
920819752 1:209369374-209369396 CAGGAAAATGGCCAGGAGGGTGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
921070105 1:211651289-211651311 CAGGAAACTGGGAAGAAGATGGG - Intergenic
921092921 1:211860222-211860244 CAGGACCAGGGGAAGAAGGAAGG + Intergenic
921509100 1:216009159-216009181 CAGAAAAGTGGGAAAGAGGTTGG - Intronic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
922196824 1:223365728-223365750 CAGGACCTTGGGAAGGTGGATGG - Intergenic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922694848 1:227724724-227724746 CAGGACAGTGGGGAGGGGCTGGG + Intergenic
922813702 1:228433923-228433945 CAGGACAATTTGAAGCAGGGAGG - Intergenic
923339068 1:232992563-232992585 CAGGACAATGGGATGGTGCAAGG + Intronic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
924434053 1:244023040-244023062 TAGGACAGTGGGAGGGTGGTGGG + Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062832989 10:618358-618380 CATGTCAGTGGGAAGGAGCTTGG - Intronic
1062916624 10:1245099-1245121 CAGGACACTGGGTGGGAGGCTGG + Intronic
1064474604 10:15673726-15673748 TAGGACAATGGGAAGCAGCTAGG + Intronic
1064817959 10:19288422-19288444 CAGGAGGCTGGGAGGGAGGTGGG - Intronic
1065732772 10:28724305-28724327 TGGGCCAATGGGAAAGAGGTTGG + Intergenic
1065821981 10:29534160-29534182 CAGGACAGGGGGATGGTGGTGGG - Intronic
1066303158 10:34114791-34114813 CAGGACAGTGGGAAGAACATGGG - Intronic
1067410004 10:46055821-46055843 CAGGACAATGTGAAGCAGGCAGG + Intergenic
1067804008 10:49380900-49380922 CAGGACAGTGGGTAGCATGTGGG - Intronic
1068523898 10:58106428-58106450 GAGGTCCATGAGAAGGAGGTCGG - Intergenic
1069694533 10:70376932-70376954 CAGGGCATTGGGAAGGAGGTAGG + Intronic
1069836416 10:71311278-71311300 AGGGGCACTGGGAAGGAGGTCGG - Intergenic
1069906767 10:71736571-71736593 CAGGCCTATGGGAATGAGATGGG - Intronic
1069920388 10:71812386-71812408 CAGGGAAATGGGCAGGATGTGGG + Intronic
1070148875 10:73793374-73793396 AAGGTCAAGGGGAAGCAGGTGGG - Intronic
1070352655 10:75608333-75608355 CAGGGAAATGGGAAGGTTGTTGG + Intronic
1070510001 10:77152440-77152462 CAGGAAAGTGGGGAGGAGATGGG + Intronic
1071472442 10:85993210-85993232 GAGGACAAGGGGAGGGATGTGGG + Intronic
1071925684 10:90406445-90406467 CAGGAAAATTGGTAAGAGGTGGG - Intergenic
1072047879 10:91674851-91674873 CCAGCCAATGGGAAGGAGGAAGG - Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073399679 10:103246321-103246343 CGGGAGAATGGGATGAAGGTTGG + Exonic
1073855896 10:107672874-107672896 CAGGACACTGGGCAAGAGCTCGG + Intergenic
1074109972 10:110415906-110415928 CAGGCCAATCTGAAAGAGGTAGG - Intergenic
1075424617 10:122332025-122332047 GGGGACAAAAGGAAGGAGGTGGG - Intronic
1075672674 10:124273162-124273184 CAGGAGAATGGGAAGGAGAGAGG - Intergenic
1075685652 10:124363666-124363688 GAGGAAAATGGGAGGGAGGAGGG + Intergenic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076043403 10:127270558-127270580 AAGGACACTGGGAAAGAGGAAGG - Intronic
1076046282 10:127296703-127296725 CAGGACAATGGGATGAGGGAAGG + Intronic
1076361671 10:129894053-129894075 CAGGTTAATAGGAAGGAGGGGGG - Intronic
1077007560 11:365488-365510 AACGACAATGGGAAGAAGTTGGG - Intergenic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077881209 11:6351976-6351998 CAGGTCAGTGGGTAGGAGGGAGG + Intergenic
1078060487 11:8039742-8039764 CAGGAGACTGTGAGGGAGGTGGG + Intronic
1078368854 11:10728679-10728701 CAGAAAAATGGGGTGGAGGTGGG + Intergenic
1080048734 11:27836694-27836716 TAGGACAATGAGGAGGAGGGTGG + Intergenic
1080145396 11:28976949-28976971 CAGGACACTGGAGAGGAGGGAGG - Intergenic
1081355090 11:42102890-42102912 AAGGACATCGGAAAGGAGGTAGG + Intergenic
1081462747 11:43286813-43286835 CAGGACACTGGGCAAGAGCTCGG + Intergenic
1081481076 11:43489744-43489766 AAGGACAAAGGAAAGGAGGGGGG + Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1081871393 11:46384212-46384234 CATGACAGTGGGAAGGGGGGAGG - Intergenic
1081971847 11:47204825-47204847 CAGGGCAGTGGAAAGGAGGGTGG - Intergenic
1081984111 11:47289218-47289240 CATGGCAATGTGGAGGAGGTGGG - Intronic
1082088979 11:48073380-48073402 CAGGACGATGGGTGGGAGTTTGG - Intronic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084148779 11:67278505-67278527 CAGGTCCCTGGGAAAGAGGTTGG - Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1085593652 11:77789380-77789402 CAGGACAATGGGCAGTCTGTTGG - Intronic
1085708697 11:78809980-78810002 TAGGACACTGGGAAGGAGTTGGG - Intronic
1085722115 11:78921654-78921676 CAGGACCAAGGCAAGGAGGGAGG + Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086474085 11:87151740-87151762 CACGAGAATGGGAAAGTGGTTGG + Intronic
1086761116 11:90632839-90632861 CAGGAGAATGGCAGGGTGGTGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087520923 11:99234275-99234297 GAAGACAATGGGAAGAAGGAAGG + Intronic
1087642109 11:100766200-100766222 TAGGCAAATGGGAAGGATGTGGG + Intronic
1088020895 11:105117652-105117674 CAGCACTGTGGGAAGTAGGTTGG + Intergenic
1089670122 11:120050766-120050788 GAGGGCAATGGGAGAGAGGTGGG + Intergenic
1090260447 11:125315171-125315193 GAGGAGAAAAGGAAGGAGGTGGG - Intronic
1090537149 11:127655568-127655590 TAGGACAATAGGAAAGAGGTTGG + Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091300198 11:134502619-134502641 GAGGACATTGGGGAGGATGTGGG - Intergenic
1091754816 12:3044436-3044458 GAGGACACTGGGCAGGTGGTGGG + Intergenic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092172269 12:6381398-6381420 CAGGTCTGTGGGATGGAGGTGGG - Intronic
1092210770 12:6645120-6645142 CAGGGAAATGGGAAGCATGTTGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092964831 12:13631474-13631496 CTGGACAAAGGCAAGGAAGTTGG + Intronic
1093099271 12:15007875-15007897 CAGTGGAATGGGAAAGAGGTTGG + Intergenic
1094085555 12:26587585-26587607 GAGGACAAGGGGAAGAAGGGTGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094194157 12:27728702-27728724 CAGGAAGAAGGGAGGGAGGTGGG - Intronic
1095740034 12:45596912-45596934 CAGGAAGATGAGAATGAGGTGGG - Intergenic
1095861658 12:46924273-46924295 CAAGGAAAAGGGAAGGAGGTAGG + Intergenic
1095962463 12:47844232-47844254 CAGGGCAATGGGATGTTGGTGGG + Exonic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096490811 12:52011878-52011900 CTGGTAAGTGGGAAGGAGGTAGG - Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096732455 12:53625740-53625762 AAGGGTAATAGGAAGGAGGTAGG - Intronic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1096846321 12:54409016-54409038 GAGGGCATAGGGAAGGAGGTGGG + Intronic
1097056997 12:56256477-56256499 GAGGCCAGTGGGAATGAGGTGGG - Intronic
1097197127 12:57249214-57249236 CAGGCCAATGGGGAGGCAGTGGG - Exonic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097285222 12:57872052-57872074 CAGCAGAATGGGAAGAAGATTGG - Intergenic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1097987690 12:65801718-65801740 CAGGAAAATGGGAAGAAAGTGGG + Intergenic
1098305194 12:69095733-69095755 CAGGACCATGGAAAGGAGTTTGG + Intergenic
1098788819 12:74794200-74794222 CAGCATAATAGGAAGGAGCTGGG + Intergenic
1100835432 12:98562675-98562697 CAGGAGAAAGGGAAGGAACTGGG + Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101657714 12:106737916-106737938 AAAGAAAATGGGAGGGAGGTGGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102178444 12:110893483-110893505 CAGGACAAGGGGAAGAAAGAGGG - Intronic
1102212752 12:111138937-111138959 CAGGAGTAAGGGAAGCAGGTGGG - Intronic
1102603383 12:114050368-114050390 TAGAACAATGGAAAGGATGTGGG - Intergenic
1104930626 12:132337590-132337612 CTGGCCAGTGGGAAGGAGTTAGG + Intergenic
1104970856 12:132530033-132530055 CATGACAATGGGAAGGGCGGAGG - Intronic
1105957267 13:25295688-25295710 GATGACAGTGGGATGGAGGTGGG + Intergenic
1106248895 13:27969228-27969250 CAGCCTAGTGGGAAGGAGGTGGG - Exonic
1106881879 13:34140329-34140351 GAGTACAAAAGGAAGGAGGTAGG + Intergenic
1108447349 13:50522876-50522898 CACGTCATTGTGAAGGAGGTAGG + Intronic
1109177615 13:59175795-59175817 CAGGACAACTGGAAGCGGGTGGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1110442230 13:75538362-75538384 GAGGTCAATAGGAAAGAGGTGGG - Intronic
1112122220 13:96425669-96425691 CAGGGCTATGGGAAGGAGTAGGG - Intronic
1112193640 13:97203098-97203120 CTGGACAATGGGAAAGCTGTAGG + Intergenic
1112621776 13:101060674-101060696 CAGGAAAGTGGGAAAGGGGTTGG - Intronic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114495167 14:23127110-23127132 CAGGACCAAGGCAGGGAGGTAGG + Exonic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1116289756 14:43018349-43018371 CAGGACAATTGGAAGTTGGGAGG + Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1118062184 14:62151625-62151647 CCAGGAAATGGGAAGGAGGTGGG - Intergenic
1118968463 14:70610682-70610704 CAGGAAAATGGGAAAGAGTAAGG - Intergenic
1119099562 14:71867556-71867578 CAAGACAAGTGGAAGGAGCTGGG + Intergenic
1119491603 14:75038948-75038970 CAGGAGAATGGCATGGAGGCAGG - Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121455289 14:94034913-94034935 TAGGAAAATGGGAAAGAGGTAGG + Intronic
1121675228 14:95747016-95747038 CAGGACCATTGGAAAGATGTGGG - Intergenic
1122355973 14:101123020-101123042 CAGGAGAATGGGAAGCAGATGGG + Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1124350328 15:28950659-28950681 GAGGACTATGGAAAGAAGGTGGG - Intronic
1124404651 15:29382620-29382642 CAGGACAGTAGGGAGGAGGCAGG - Intronic
1125838849 15:42779155-42779177 CAGCACTTTGGGAGGGAGGTGGG + Intronic
1126370247 15:47938338-47938360 GGGGAAAATGGGATGGAGGTGGG + Intergenic
1126793688 15:52243236-52243258 TAGGAAGATGGGAAGGAGGTGGG + Intronic
1127142336 15:55990731-55990753 GAGGTGCATGGGAAGGAGGTGGG + Intronic
1127976552 15:64001493-64001515 GAGGAGGATGGGAAGGAAGTGGG + Intronic
1128113010 15:65088324-65088346 GAGGAGAATGGGCAGGAGGGAGG + Intergenic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128978979 15:72173065-72173087 GATGACAATGGGAAGGAGCTTGG + Intronic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129891010 15:79071907-79071929 TAGGACAGTGGGAAGGAGATGGG - Intronic
1129926009 15:79364885-79364907 CAGGACACTGGGAAAGAGCTTGG + Intronic
1131274949 15:90973089-90973111 CAGGACAGAGGGCAAGAGGTAGG + Intronic
1131788560 15:95939238-95939260 AAGGGCAATGGGATGGAGCTAGG + Intergenic
1132359594 15:101201482-101201504 CAGAAGGATGGGAAGGAGTTAGG - Intronic
1132567710 16:630928-630950 CAGGGCAGAGGGGAGGAGGTTGG - Exonic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1133219188 16:4311613-4311635 CAGCACAATGGCAGGGAGGGGGG + Intergenic
1133474650 16:6108690-6108712 CAGGACCTTGAGAAGGAGATAGG - Intronic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1134123152 16:11598751-11598773 CATGACCATGGGGAGGAGGCAGG - Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1135728045 16:24872305-24872327 CATGACCATGGGCAGGAGGGAGG - Intronic
1136186354 16:28591009-28591031 GAGGACAAAGGGAAGGAGTGGGG - Intronic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1136725629 16:32354987-32355009 CAGTACTTTGGGAGGGAGGTGGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1138182991 16:54955447-54955469 CAGTACAAAGGGACTGAGGTGGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1140482186 16:75267629-75267651 CAGGAGCAAGGGAGGGAGGTGGG - Intronic
1140821092 16:78664077-78664099 GAGGACAATGCGTAGGAGGCAGG + Intronic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1141920550 16:87132841-87132863 CAGGGCATTGGGAAGGCGGGTGG - Intronic
1203000802 16_KI270728v1_random:162767-162789 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1203132404 16_KI270728v1_random:1699172-1699194 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143510621 17:7393581-7393603 CAGGTGAGTGGGAAGGAGGGAGG - Exonic
1143888604 17:10085348-10085370 CAGGCCTAGGGGATGGAGGTGGG - Intronic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146250616 17:31339906-31339928 CAGGACAATGGAGGGAAGGTGGG + Intronic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1146647216 17:34583307-34583329 CAGGACTCAGGGAAGGAGGTTGG - Intronic
1147318815 17:39633781-39633803 CAGGCCTACGGGAAGGAGGCTGG + Intronic
1147331960 17:39704605-39704627 GGGGACAATGGTAAGGAGATGGG + Intronic
1147347839 17:39814754-39814776 CAGGACCATGGGAAGGGCCTAGG - Intronic
1147536927 17:41327501-41327523 CAGGACAATGGAAAGTGGGAGGG - Intergenic
1147544863 17:41393525-41393547 CAGGCCAGTGGGAAGGAGGGTGG - Intronic
1148117308 17:45183889-45183911 CAGGACAATGGAAAGGTGCCTGG - Intergenic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149748082 17:59118918-59118940 CACGAGCATGGGAAGGAGGAAGG - Intronic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150943583 17:69719949-69719971 GAGGACAATGGTAAGGAAGTAGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151793517 17:76325696-76325718 CAGGAGAATGGCATGGAGGCAGG - Intronic
1152032354 17:77851779-77851801 CAGGACAGTGGGCAGGAGGATGG - Intergenic
1152168226 17:78724702-78724724 CAGGAGACTGGAAAGGAGGGAGG - Intronic
1152681741 17:81671980-81672002 CAGCCCTATGGGAGGGAGGTGGG + Intronic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1154261098 18:12833543-12833565 CAGAAGAATGGGAGGGAGTTAGG + Intronic
1154310875 18:13265413-13265435 CAGCACAGTGGGAAGGGGGAGGG - Intronic
1156020477 18:32594460-32594482 CTTGACAATGGGATGGAGGATGG + Intergenic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1156557686 18:38086069-38086091 CAGGACAAAGGGAAGAAATTAGG + Intergenic
1156635208 18:39019804-39019826 CAAGAAAATGGGAAGGAATTGGG - Intergenic
1157291415 18:46412469-46412491 CAGGACATTTGGCAGGAGGGTGG - Intronic
1157453924 18:47809499-47809521 CAGCTCACTAGGAAGGAGGTGGG - Exonic
1157859208 18:51125653-51125675 CAGGACAATGGACAAGAGCTTGG - Intergenic
1157877978 18:51291510-51291532 AAGGAAAATGGGAGGGAGGGAGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159092898 18:63869734-63869756 CAAGCCAAAGGGAAGGAGTTGGG + Intergenic
1160198448 18:76776882-76776904 GAGTACAATGGGAGGCAGGTTGG + Intergenic
1160379341 18:78439642-78439664 CAGGACAAAGGGAAGAGGGTGGG + Intergenic
1160676851 19:395573-395595 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676913 19:395875-395897 AAGGACGATGGGAAGGATGATGG + Intergenic
1160676919 19:395899-395921 AAGGACAATGGGAAGGATGATGG + Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1160801870 19:974107-974129 CAAGGCAATGGGGAGGTGGTTGG - Exonic
1161711026 19:5848178-5848200 CAGGAAAATGGAAACGGGGTGGG - Intronic
1162080463 19:8214885-8214907 AAGGGCAGTGGGGAGGAGGTGGG + Intronic
1162126604 19:8502703-8502725 GAGGAGGAAGGGAAGGAGGTGGG + Exonic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162316059 19:9938695-9938717 CAGGTCAATGAGAAAGAGCTTGG + Intergenic
1162497410 19:11030979-11031001 CAAGACAATGTGGAGGAGGCTGG - Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162969167 19:14169807-14169829 AGGGATAATGGGAAGGAGGGAGG + Intronic
1163827859 19:19533594-19533616 GAGGAGGATGGGGAGGAGGTAGG - Intronic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1164443466 19:28297980-28298002 CAGGGCAATGGGGAGGGGGGAGG - Intergenic
1164459394 19:28434425-28434447 CAGAAAAGTGGGAAAGAGGTGGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164604031 19:29583134-29583156 CAGGTCAATGGGATGAAGGAGGG - Intergenic
1164891067 19:31824057-31824079 CAGGATACTGGGATGGGGGTGGG + Intergenic
1165275283 19:34745713-34745735 CAGGTCTATGGGAAGGAAGGAGG + Intergenic
1165604893 19:37093465-37093487 CAGCACTTTGGGAGGGAGGTGGG - Intronic
1166143924 19:40821676-40821698 CAATACAATGGAAAGGAGTTTGG - Intronic
1166183684 19:41125420-41125442 CAATACAATGGAAAGGAGTTTGG + Intronic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1166840377 19:45693396-45693418 TGGGACCTTGGGAAGGAGGTGGG - Exonic
1167530262 19:50011593-50011615 CAGGACCATGGGAGGGAGTTTGG - Intronic
1167530278 19:50011669-50011691 CAGGACCACGGGAGGGAGTTTGG - Intronic
1167530295 19:50011745-50011767 CAGGACCACGGGAGGGAGTTTGG - Intronic
1167530312 19:50011821-50011843 CAGGACCACGGGAGGGAGTTTGG - Intronic
1167720441 19:51176268-51176290 CAGGACAGTGGGGAGGTGGCTGG - Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1168156111 19:54473742-54473764 CAGCTCAGTGGGAAGAAGGTGGG + Intergenic
925516414 2:4688489-4688511 TAAGACTATGGGAAGGAGGAAGG + Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926348143 2:11968302-11968324 CAGGACTTTGGCAAGGAGGCAGG + Intergenic
927267886 2:21173306-21173328 CAAGACAATGGGAGAAAGGTCGG + Intergenic
927787217 2:25982266-25982288 GAGGAAAATGGGATGGGGGTGGG + Exonic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928249572 2:29663425-29663447 GAGGACGATGGGAAGGAGGAAGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
929444227 2:41990141-41990163 CAGGAAAATGGGGTGGGGGTGGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929740401 2:44593611-44593633 CAAGACAGTGGGCAGGAGGCAGG - Intronic
930589336 2:53308746-53308768 CAAGAAAAGGGGATGGAGGTGGG - Intergenic
931851555 2:66256279-66256301 CAGGACAAGTGGAAGGAATTGGG - Intergenic
933124253 2:78584470-78584492 CATGAAAATGGGAAATAGGTTGG - Intergenic
933918077 2:87016833-87016855 CAGGACCACGGGATGGAGATGGG - Intronic
934004917 2:87753081-87753103 CAGGACCACGGGATGGAGATGGG + Intronic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
935767876 2:106387112-106387134 CAGGACCACGGGATGGAGATGGG + Intergenic
935878783 2:107540192-107540214 CAGAACACTGGGCGGGAGGTTGG - Intergenic
936672386 2:114672370-114672392 TAGGAGAATGGGAAGGAAATGGG - Intronic
936887703 2:117333150-117333172 AAGGAGAATGGGAAGGAAATGGG + Intergenic
937253875 2:120541222-120541244 AAGGACAAAGGGGAGGAGGTGGG - Intergenic
937440489 2:121911232-121911254 CAGGATAATGGCAAGGTGGGGGG - Intergenic
937573354 2:123390973-123390995 AAGGAGAATGGGGAGGAGGAAGG - Intergenic
938138794 2:128780307-128780329 GAGGACAATGGAAAGGAAGCAGG - Intergenic
938190368 2:129274106-129274128 CTGGACAATGGGAGCTAGGTAGG + Intergenic
939323321 2:140653075-140653097 CAAGACAATAGAAAGGATGTAGG + Intronic
939454597 2:142418012-142418034 AAGGACGATGGGGAGGAGGGAGG - Intergenic
940004442 2:148998300-148998322 AGGGACACAGGGAAGGAGGTAGG + Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
943765070 2:191652046-191652068 AAGGACAAAGGGAATGAGATAGG + Intergenic
945983880 2:216339326-216339348 GAGGACCATGGGAAGTAGGAGGG - Intronic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947682420 2:232046781-232046803 CCCCAAAATGGGAAGGAGGTGGG - Intronic
947817657 2:233048807-233048829 GGGGACAATGGGATGGAGGCGGG + Intergenic
948193976 2:236081230-236081252 AAGGACAGTGGGCAGGAGGCCGG + Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948485384 2:238277740-238277762 GACGACAGTGGGAAGGAGCTGGG - Exonic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
948718483 2:239881397-239881419 CAGGGCAGTGGGCAGGAGGGAGG - Intergenic
948911889 2:241009035-241009057 CAGGACATGGGGATGGAGCTTGG + Intronic
1168821276 20:775173-775195 CAGGAGCCTGGGAAGGAGGCTGG - Intergenic
1168910071 20:1440504-1440526 CAGGTCAAAGGGATGGAGGGTGG + Intergenic
1169087530 20:2836595-2836617 CTGGTCTATGGGGAGGAGGTGGG - Intronic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1170594042 20:17792271-17792293 AAGGACATGGGAAAGGAGGTGGG + Intergenic
1170662510 20:18356996-18357018 CAGGACAACAGTAAGGAAGTTGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171147159 20:22794949-22794971 CAGGAAGCTGGGAAGGTGGTAGG + Intergenic
1171312009 20:24152097-24152119 GAGCACAATGGGAATGAGGCTGG + Intergenic
1171557988 20:26095699-26095721 CGGCATAATGGGAAGGAAGTAGG - Intergenic
1171969992 20:31558403-31558425 GAGGACCATGGGGAGGAGTTGGG - Intronic
1172360528 20:34309847-34309869 CAGGACAGAAGGAAGGAGGGAGG + Intronic
1173031151 20:39361476-39361498 CAGAACAATGGAAAGAAGTTTGG - Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173305150 20:41841110-41841132 AAGGACAGAGGGAGGGAGGTAGG - Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174338594 20:49882346-49882368 AGGGGCAGTGGGAAGGAGGTAGG - Intronic
1174358732 20:50015133-50015155 TAGGGCAATGGGAAGCAGATGGG + Intergenic
1174747279 20:53075832-53075854 GGGGACCATGGGAAGGAGTTTGG + Intronic
1175385423 20:58591893-58591915 CATGACAATGTGAGGGAGGCAGG + Intergenic
1175935710 20:62513008-62513030 GAGGACAACGGGAAGGAAGTGGG - Intergenic
1176261686 20:64185232-64185254 ATTGACAGTGGGAAGGAGGTGGG + Intronic
1178069735 21:28950886-28950908 TAGGACAATGGGAAGGGGAAGGG + Intronic
1179024621 21:37669215-37669237 CAGGACAACTGGAAGGTGGGGGG - Intronic
1179191388 21:39125161-39125183 CAGGACAAGTGGGAGGAGGGAGG - Intergenic
1179568604 21:42264722-42264744 GAGGAGAGAGGGAAGGAGGTGGG + Intronic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180149682 21:45941158-45941180 CAGGCCCATGGGCAGGAGGCTGG + Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180592494 22:16953235-16953257 CAGGACAATGGGAGGGTGCTGGG - Intergenic
1181373133 22:22433714-22433736 CAGGAGAAAGGGTAGGAGGGGGG - Intergenic
1181906219 22:26198944-26198966 CTGGCCAATGGGAAGCTGGTGGG + Intronic
1182227282 22:28808736-28808758 CAGGACAATTAGAAGTAGGTGGG + Intergenic
1182339656 22:29609143-29609165 CAGGAGAATGGGATGAAGGTTGG + Intronic
1182743557 22:32587309-32587331 GAGGACATAGGGAGGGAGGTGGG + Intronic
1183319053 22:37154083-37154105 TAGGACCAAGGGAGGGAGGTAGG + Intronic
1183492132 22:38122331-38122353 CAGGACAATGTCCAGGGGGTTGG + Intronic
949705604 3:6813463-6813485 TAGGACTATGAGAAGGTGGTAGG - Intronic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950266675 3:11578413-11578435 CTGGACCATGGGAAGGCGGCTGG - Intronic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950736362 3:15011880-15011902 CATGACATTGGGAAGGAGACAGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952535373 3:34303785-34303807 GAGGACATTAGGAAGGAGGTTGG + Intergenic
952948502 3:38497768-38497790 CAAGATAATGGGTAGGTGGTTGG + Exonic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953259478 3:41323667-41323689 CAGGACACTGGGAGGGGGGTCGG - Intronic
953337615 3:42107095-42107117 CAGGACAGGGGGAGGGATGTGGG + Intronic
953888536 3:46733899-46733921 CAGGACCATGGGTAGGAGGCAGG + Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954692895 3:52405161-52405183 CTGGACAATGGGAGTGGGGTTGG + Exonic
954747971 3:52797735-52797757 AAGGCCAATGGGAATGAGATGGG - Intronic
955169816 3:56552220-56552242 CAAGACAACAGGAAGGAGGAGGG + Intergenic
956058887 3:65329982-65330004 CATGACAATGGGAATGAGGGAGG - Intergenic
956193958 3:66633751-66633773 CAGGACAAAGGAAAGGAAGTAGG + Intergenic
956314421 3:67918298-67918320 CAAGACAAGGGGAAGAAGATTGG - Intergenic
956724457 3:72145750-72145772 CTGGAGAGTGGGAAGGGGGTAGG - Intergenic
956821279 3:72956644-72956666 CAGCACTTTGGGAGGGAGGTGGG + Intronic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
959444787 3:106425766-106425788 GAGGACAAGGGGAAGAAAGTGGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960096820 3:113696963-113696985 TAGGTGAATGGGAAAGAGGTGGG + Intergenic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960433550 3:117598997-117599019 CAGGACACTGAGAAGAAGTTAGG - Intergenic
960702376 3:120451050-120451072 GAGGAGAATGGGGAGGAGCTGGG - Exonic
962929345 3:140022675-140022697 GTGGAGAATGGGATGGAGGTGGG + Intronic
963038675 3:141052773-141052795 CAGGGCTCTGGGAAGGAGGGAGG + Intronic
965774581 3:172215302-172215324 CAGGCAAATGGGATGGAAGTGGG + Intronic
965937051 3:174127508-174127530 CAGGAATATGGGAAGAAGGAGGG - Intronic
966027883 3:175308408-175308430 CAAAGCAATGGAAAGGAGGTAGG + Intronic
967306399 3:188063764-188063786 CAGGACATTTTGAAGCAGGTAGG + Intergenic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968673313 4:1863923-1863945 CAGGACACAGGGAGGGAAGTGGG + Intergenic
968773742 4:2526031-2526053 CAGGAGAATGGCATGGAGGCAGG + Intronic
968905852 4:3450168-3450190 CAGGACGCCAGGAAGGAGGTGGG - Intergenic
969460248 4:7325173-7325195 CAGGGCACTGGGGAGTAGGTGGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970750995 4:19360917-19360939 AAGGAAAATGGGAAGGAGACAGG - Intergenic
972428062 4:38953764-38953786 CAAGGCAATGGGATGGAGGAAGG - Intergenic
972910164 4:43805785-43805807 CACAACAATGTGAAAGAGGTTGG - Intergenic
973185116 4:47317723-47317745 AAGGAAAATTGGAAAGAGGTAGG + Intronic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
974453848 4:62100782-62100804 CAGGAAAATGGGAATTAGGGAGG - Intergenic
975415630 4:74100880-74100902 CAGGACCATGGGAAGTAATTAGG + Intergenic
975825591 4:78316538-78316560 CAGGACCATGGTCAGGAGTTGGG - Intronic
980480417 4:133380048-133380070 CAGGACACTGGGCAAGAGCTCGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981783028 4:148446215-148446237 CAGGACAGTGGGAATGTGGAAGG - Intergenic
983292758 4:165826755-165826777 ATGGAAAATAGGAAGGAGGTGGG - Intergenic
984883700 4:184431372-184431394 CAGGACACTGGAAAGAAGGGAGG + Intronic
985652757 5:1114573-1114595 AAGGACAGAGGGATGGAGGTGGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986119269 5:4816478-4816500 CAGGACACCGAGAACGAGGTCGG + Intergenic
986252710 5:6075363-6075385 AAGGAACATGGGAGGGAGGTAGG + Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987581979 5:19805682-19805704 CAGGACTATTTGAAGGTGGTTGG - Intronic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
992452247 5:76885377-76885399 CAGGAAAGTGGGAATGAGGTGGG + Intronic
992452272 5:76885450-76885472 CAGGAAAGTGGGAACGGGGTGGG + Intronic
992452297 5:76885524-76885546 CAGGAAAGTGGGAACGGGGTGGG + Intronic
992452322 5:76885598-76885620 CAGGAAAGTGGGAATGGGGTGGG + Intronic
992452336 5:76885635-76885657 CAGGAAAGTGGGAACGGGGTGGG + Intronic
992452350 5:76885672-76885694 CAGGAAAGTGGGAATGGGGTGGG + Intronic
992452363 5:76885709-76885731 CAGGAAAGTGGGAACGGGGTGGG + Intronic
993026914 5:82657648-82657670 AAGGGCCATGGGAGGGAGGTTGG - Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
996374304 5:122787684-122787706 CCGCACAATGGGAATGATGTGGG - Intronic
997248974 5:132374325-132374347 CAGGACAATGGGGAGGGAGTGGG - Intronic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999275744 5:150328942-150328964 GAGGACCATGGTAAGGAGTTTGG - Intronic
999427595 5:151501010-151501032 CAGGAGAATGGGAGGCAGGGAGG + Intergenic
1001331623 5:170766568-170766590 CAGAAAAGTGGGAAAGAGGTTGG + Intronic
1001406299 5:171479899-171479921 CAGGAGAATGGCACAGAGGTGGG - Intergenic
1001713253 5:173794638-173794660 CAGGACAGTGGGGAGAAGGGTGG + Intergenic
1001758033 5:174185856-174185878 CAGGACAGTGGCAAGAGGGTGGG - Intronic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001801837 5:174551243-174551265 CAGGAAAATAGAAAGCAGGTTGG - Intergenic
1001924660 5:175627386-175627408 CAGGGCTATGGGAAGGAGCAAGG + Intergenic
1002524770 5:179808948-179808970 CAGGAGAATGGGGTGAAGGTGGG - Intronic
1002786900 6:408383-408405 AAAGCCAATGGGAAGGAGGGCGG - Exonic
1002894847 6:1371932-1371954 CAAGACAGTGGGGAGGTGGTAGG - Intergenic
1003100828 6:3175286-3175308 TAGGACAACTGGAAGGAGGGGGG + Intergenic
1004094494 6:12539133-12539155 GAGCACAAGGGGAAGGTGGTTGG + Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1006401389 6:33819681-33819703 CACCACGATGGGGAGGAGGTTGG + Intergenic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006572125 6:35014454-35014476 CATGCCAAGGGGAAGGAAGTGGG - Intronic
1006652441 6:35562820-35562842 AAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1006793482 6:36718137-36718159 CCGGGCAGTGGGAAGGAGGCAGG - Intronic
1007278326 6:40691763-40691785 CAGGACCCTGGGAGGCAGGTTGG - Intergenic
1007311440 6:40949426-40949448 CAGGACAATTCGAAGGATGGGGG - Intergenic
1007502052 6:42305760-42305782 CAGGAAAATGGAGAGGAGGGAGG + Intronic
1011700426 6:89950265-89950287 CAGGACAGGGGCCAGGAGGTAGG - Exonic
1011719860 6:90144337-90144359 AAGGACAGAGGGAAGGAGGGAGG + Intronic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1012932785 6:105334230-105334252 CAAGACCATGGGAAGGAATTTGG - Intronic
1012986192 6:105878566-105878588 CAGGACAGTGGGAAGGGGGGCGG + Intergenic
1013224011 6:108106602-108106624 CAGGAGAAATGGAAGGCGGTTGG - Intronic
1013336674 6:109170092-109170114 CTGGACAATGGTCAGAAGGTAGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013522046 6:110942448-110942470 CAGCACTATGGGAGCGAGGTAGG - Intergenic
1013597457 6:111672924-111672946 CAAGACAAAGGGGTGGAGGTGGG - Intronic
1014243467 6:119042233-119042255 CAGGATAATGGGAAGAAAGGGGG + Intronic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015224977 6:130847151-130847173 GAAAACAATGGGAAGGATGTCGG - Intronic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1016374037 6:143402318-143402340 CAGGACAACGGGAAAGTGGGGGG + Intergenic
1017859472 6:158382061-158382083 CAGGAGTATGGGGAGGAGGTAGG + Intronic
1018128713 6:160707253-160707275 CAGGACCACGGGATGGAGATGGG + Intronic
1018611764 6:165654254-165654276 CAGGACAATGAGGAGGATGACGG - Intronic
1018801377 6:167225169-167225191 CAGGACAATGGGAATGCAGTTGG - Intergenic
1018934661 6:168265838-168265860 CAGGACAATGGAAAGAAGGGTGG - Intergenic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019281959 7:205101-205123 CAGGACCCTGGAAAGGAGGCGGG + Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019883465 7:3883705-3883727 CTAGACAATGGGAGGGAGGGAGG - Intronic
1020897580 7:13960101-13960123 GAGGACAATGGAAAGGAAGACGG + Intronic
1021107565 7:16655667-16655689 CAGGAGAATAGGAGTGAGGTGGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022446147 7:30472297-30472319 GAGGTGAATGGGAAGGATGTGGG - Intronic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1023050331 7:36245520-36245542 CAGTAGATTGGGTAGGAGGTGGG + Intronic
1023272490 7:38479608-38479630 CAGTGCAAAGGAAAGGAGGTGGG + Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1024943502 7:54785749-54785771 CAGGGCACTAGGAAGGGGGTGGG - Intergenic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026670070 7:72382605-72382627 GAGGAGAAAGGGAGGGAGGTGGG - Intronic
1026944108 7:74305441-74305463 GGGGACACTGGGAGGGAGGTGGG - Intronic
1027131122 7:75592158-75592180 AAAGACAAAGGGAAGGAGGATGG + Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1029606353 7:101601627-101601649 CAGGACAATGGGTGGCAGGGGGG - Intergenic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031355807 7:120785053-120785075 GATGACAATAGGAAGGGGGTTGG + Intergenic
1031417066 7:121507540-121507562 GAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1032208071 7:129886676-129886698 CAGGAGAGTAGGAAGCAGGTGGG - Intronic
1032269283 7:130388896-130388918 CAGGAGAATGGGAAGGAGTGGGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1034266339 7:149782855-149782877 CTGGTCAATGGGCAGGATGTGGG + Intergenic
1034283714 7:149870821-149870843 CAGAACAATGGGTGGAAGGTAGG + Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035261513 7:157664516-157664538 CAGCACTTTGGGAAGTAGGTGGG + Intronic
1035271212 7:157721007-157721029 CAGGACAGCGGGATGGACGTGGG + Intronic
1035289705 7:157830056-157830078 AAGGACAGTGGGAGGGAGGGTGG - Intronic
1036236712 8:7045144-7045166 TGGAACAATGGGAAGGAAGTAGG + Intergenic
1036396637 8:8376632-8376654 CAGGACCTTGGGATGGAGGCTGG + Exonic
1036776791 8:11618278-11618300 GAGGACAATTGGGAGGTGGTAGG - Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037780432 8:21864754-21864776 CAGAGCAGTGGGAAGAAGGTGGG + Intergenic
1037922708 8:22818741-22818763 CAGTAGCATGGGAAGGATGTTGG + Intronic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038660564 8:29493141-29493163 CAGGCCAGTGGGAAGGAGGTGGG - Intergenic
1039277441 8:35948869-35948891 AAGGACAGAGGGAAGGAGGGAGG + Intergenic
1039970182 8:42315515-42315537 CAGGGCCAGGGGAAGGAGTTTGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042152419 8:65802573-65802595 CAGGATAATGGGAAGGTACTTGG + Intronic
1043338637 8:79208964-79208986 AAGGACATTAGGGAGGAGGTTGG - Intergenic
1043395729 8:79834117-79834139 AAGGTAAATGGGAAGGAAGTGGG - Intergenic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045938106 8:107706398-107706420 CAGGACACTGGGCAAGAGCTCGG - Intergenic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1048326455 8:133442942-133442964 GAGGACAGTGGAAAGGAGGCTGG - Intergenic
1048732859 8:137462996-137463018 CAGGACATTGGGAAAGGGATGGG + Intergenic
1049117791 8:140704731-140704753 CAGAGCAATGGGAAGTACGTAGG - Intronic
1049237939 8:141522025-141522047 CAGGTCAGTGGGAAGAAGCTCGG - Intergenic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1049597225 8:143490270-143490292 CAATACAATAGAAAGGAGGTAGG + Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049655439 8:143794991-143795013 CAGGACAACAGGACGGAGGTGGG + Intronic
1049713208 8:144076678-144076700 CAGGACAATGAGGACGATGTTGG - Intergenic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1052228769 9:26121576-26121598 CAGGAAAAAGGGAAGGTGTTTGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052885939 9:33648010-33648032 CAGGACACTGGGCAAGAGCTCGG + Intergenic
1053054641 9:34987427-34987449 CAGGACAATGGGACTGAGGGCGG + Intergenic
1054452499 9:65410683-65410705 CAGGACCACTGGAAGGAGGGAGG + Intergenic
1054981233 9:71209325-71209347 CATGAAAAATGGAAGGAGGTGGG + Intronic
1055959480 9:81806718-81806740 TAGAACAATGGGAAAGATGTGGG + Intergenic
1056320730 9:85432449-85432471 AGGGACAAAGGCAAGGAGGTGGG + Intergenic
1060319804 9:122547527-122547549 CAGGAGGATGGGAAGGTGGGAGG - Intergenic
1060738053 9:126079195-126079217 CAGAAAAATGGGAAAGGGGTTGG + Intergenic
1061607372 9:131721245-131721267 CAGGACATTTCGAAGGGGGTAGG + Intronic
1062060525 9:134493037-134493059 CAGGACAGCAGGGAGGAGGTGGG + Intergenic
1062389406 9:136327960-136327982 CAAGCCAAGGGGAAGGGGGTGGG + Intronic
1062592875 9:137281832-137281854 CAGGGCTAGGGGAAGGAGCTGGG + Exonic
1185622920 X:1464520-1464542 GCGGAGAATGGGCAGGAGGTGGG + Exonic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186319301 X:8406972-8406994 CAGGGAAATGTGAATGAGGTTGG + Intergenic
1187500252 X:19833270-19833292 AAAGACCATGGGAAAGAGGTAGG - Intronic
1187500276 X:19833351-19833373 AAAGACCATGGGAAAGAGGTAGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188132860 X:26459392-26459414 CAGGAGAATGGAAAGTAGATTGG + Intergenic
1189055399 X:37694386-37694408 GAGGAGATTGAGAAGGAGGTGGG + Exonic
1189098401 X:38163706-38163728 CAGGAGAATGGGGTAGAGGTGGG + Intronic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1189699844 X:43707130-43707152 CAGGGAAATGGGAAAGGGGTGGG + Intronic
1189718196 X:43886202-43886224 GAGGTCAATGAGAAGGTGGTAGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1192428817 X:71099146-71099168 AAAGGCACTGGGAAGGAGGTAGG + Intronic
1192442673 X:71186215-71186237 CAGGACAATGGGTACATGGTAGG + Intergenic
1193372602 X:80714517-80714539 CAGGACAACTGGAAGGTGGGTGG - Intronic
1195291460 X:103434491-103434513 CAGGAAAGTGGAAAAGAGGTGGG + Intergenic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1195734033 X:107994952-107994974 CAGGACAATGAGATGAATGTTGG - Intergenic
1196039639 X:111188300-111188322 CAGGACAGTGGGAATGGGCTTGG + Intronic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1198230490 X:134684539-134684561 TAGGACAATGGGAAGTAGCTAGG - Intronic
1198875153 X:141216742-141216764 CAGGACAAAGGGAAGGTGGTTGG + Intergenic
1198911119 X:141615737-141615759 CAGGATAGTGGCAAGGTGGTAGG + Intronic
1199606337 X:149582565-149582587 CAGGACAATGATCAGGAGGGCGG + Exonic
1199632785 X:149786803-149786825 CAGGACAATGATCAGGAGGGCGG - Exonic
1199907232 X:152245585-152245607 CTGGAGAATGGAAATGAGGTTGG - Intronic
1200822860 Y:7605975-7605997 CAGTCCAGTGGGAAGGATGTAGG + Intergenic
1200827417 Y:7659009-7659031 CAGCACTACGGGAAGGAGTTAGG + Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1201888728 Y:18917797-18917819 CAGGACAATTGGAAGTAGGAAGG - Intergenic
1202237195 Y:22725114-22725136 CAGTCCAGTGGGAAGGATGTAGG - Intergenic