ID: 926148526

View in Genome Browser
Species Human (GRCh38)
Location 2:10411655-10411677
Sequence CAGGCTGAGCACTGGGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926148526_926148534 -4 Left 926148526 2:10411655-10411677 CCGGCATCCCAGTGCTCAGCCTG 0: 1
1: 0
2: 2
3: 44
4: 362
Right 926148534 2:10411674-10411696 CCTGGGATTCGGCACTCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 104
926148526_926148532 -5 Left 926148526 2:10411655-10411677 CCGGCATCCCAGTGCTCAGCCTG 0: 1
1: 0
2: 2
3: 44
4: 362
Right 926148532 2:10411673-10411695 GCCTGGGATTCGGCACTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
926148526_926148535 9 Left 926148526 2:10411655-10411677 CCGGCATCCCAGTGCTCAGCCTG 0: 1
1: 0
2: 2
3: 44
4: 362
Right 926148535 2:10411687-10411709 ACTCAGAGGGCCCGACAGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926148526 Original CRISPR CAGGCTGAGCACTGGGATGC CGG (reversed) Intronic
900302236 1:1983590-1983612 CAGGCACGGCTCTGGGATGCGGG + Intronic
900370339 1:2329432-2329454 CAGGGAGGGCACTGGGAAGCTGG - Intronic
900397846 1:2460516-2460538 GAGTCTGAGGACTGGGATCCTGG + Intronic
900458047 1:2786838-2786860 CAAGCTGAGCAAGAGGATGCAGG + Intronic
900661963 1:3789250-3789272 CAGGCTGTGCCCTGGGCTGGTGG - Intronic
901206944 1:7502918-7502940 CAGGGTGAGCCATGGGGTGCGGG - Intronic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901490621 1:9594659-9594681 GAGGCTGGGCCCTGGGAAGCAGG - Intronic
901742304 1:11350295-11350317 CAGGAGGAGGGCTGGGATGCAGG - Intergenic
901971566 1:12912852-12912874 CAGGCTCAGCACTGCAATCCCGG - Intronic
902013601 1:13288888-13288910 CAGGCTCAGCACTGCAATCCCGG + Intergenic
902096474 1:13950067-13950089 CAGGCTCAGCCCTGGGGTGTGGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902941225 1:19801307-19801329 CAGGCTCTGAGCTGGGATGCTGG - Intergenic
903152685 1:21423310-21423332 CAGGATGATCACTGGAATACAGG + Intergenic
903550843 1:24156664-24156686 GAGGCTGAGCCCTGGGATGGGGG + Exonic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
904932362 1:34099473-34099495 AAGGCAGAGGTCTGGGATGCTGG - Intronic
905229794 1:36507904-36507926 CCTGCTGAGCACTGAGATGGAGG + Intergenic
905390727 1:37634149-37634171 CAGGCTGCGGACTGGGGTGGGGG + Intronic
905475427 1:38223721-38223743 TGGGCTGAGCACTGGCATGAGGG + Intergenic
905735653 1:40324073-40324095 CTGGCAGAGAACTTGGATGCTGG - Intergenic
905920117 1:41713802-41713824 CATGCTGAGCTCTGGAATGCAGG + Intronic
906525393 1:46490519-46490541 CAGGCTGGGAACTGGGCTGCCGG - Intergenic
907585208 1:55610808-55610830 CTGGTTCAGGACTGGGATGCTGG + Intergenic
910984562 1:92992982-92993004 AAGGCTGACCCCTGGGATTCTGG - Intergenic
912209797 1:107545359-107545381 CAGGTGGAGCACTGAGCTGCTGG - Intergenic
912312070 1:108632882-108632904 CAGGCTGAGCCCGGGGTTGAAGG - Intronic
912978258 1:114348776-114348798 CAGCCTGAGCACAGGAATCCTGG + Intergenic
914380545 1:147112040-147112062 CAGGCTCAGCAGTGAGCTGCTGG - Intergenic
915118970 1:153616827-153616849 AAGGCTGGGCTCTGGGATCCAGG - Intronic
916480221 1:165208054-165208076 GAGGCTGAGCTCTGGTAAGCTGG - Exonic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
917314305 1:173708861-173708883 CAGGATTAGCACTGGGACCCCGG + Intergenic
917359442 1:174159776-174159798 CCAGCCGAGGACTGGGATGCGGG + Intronic
919144313 1:193614007-193614029 TGGCCTGAGCACTGGGATGCAGG + Intergenic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922797461 1:228347573-228347595 CATGCTGAGCACTGAGAAGTGGG - Intronic
922806307 1:228391713-228391735 CAAGATGGGCACTGGGGTGCAGG + Intergenic
923296676 1:232601142-232601164 CAGGCTGGGCCCTGGGACACAGG + Intergenic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
923990111 1:239426961-239426983 CAGGCTGAGAAATGGGTTGAAGG + Intronic
924212545 1:241785808-241785830 GAGGCTGAACTCTGGGATGCAGG + Intronic
1065963587 10:30753493-30753515 CAGGCTTAGCACACGGCTGCAGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1067022037 10:42809486-42809508 CAGGCAGATCACTGGCATTCAGG - Intronic
1068275691 10:54792853-54792875 CAGGTTGAGCACTGGCAGGGTGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070829835 10:79411558-79411580 CACACTGAGCCCTGGGAGGCTGG - Intronic
1070839649 10:79475270-79475292 CAGGCAGGGCACTCGGCTGCAGG + Intergenic
1072610003 10:97011568-97011590 CCTGCTGAGGACTGGGAGGCTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073008041 10:100339639-100339661 CAGGCTGACACCTGGGATCCGGG - Intergenic
1074888549 10:117715263-117715285 GATGCTGAGCAATGGGCTGCAGG - Intergenic
1075375955 10:121978381-121978403 AAGGCTGAGAAGTGGGGTGCAGG - Intergenic
1077526666 11:3070103-3070125 CAGGCTGATCACTGGACTCCAGG - Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1079029755 11:16977676-16977698 CAGGTTTGGCACTGGGATGATGG - Intronic
1079963652 11:26954015-26954037 CAAGCTGTTCACTGTGATGCAGG + Intergenic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081854426 11:46294981-46295003 CAGGCTGAGCTGTGGGATAAGGG - Intronic
1082978755 11:59101503-59101525 CATGCTGAGCACCGGAATTCTGG + Intergenic
1083603331 11:63962116-63962138 CAGGCCTAACACTGGGGTGCTGG - Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1083946659 11:65927342-65927364 CAGGAGTAGGACTGGGATGCAGG + Intergenic
1084147854 11:67274614-67274636 CAGGCTGTGCACTGGGAGACTGG - Intronic
1084371821 11:68750346-68750368 CGCGCTGAGCTCTGGGATCCCGG + Exonic
1084438944 11:69159730-69159752 CAGGCAGAGCCCTGGGCTGCCGG - Intergenic
1084537103 11:69763748-69763770 CCGGCCGAGCACAGGGATGTGGG + Intergenic
1084546436 11:69817357-69817379 CAGCCTGCGCACTGGGAAGGCGG - Intronic
1085052920 11:73388971-73388993 CAGGCAGAGCCCGGGGAGGCCGG - Intronic
1085183983 11:74559837-74559859 GCGGCTGAGCACTTGGAAGCTGG - Intronic
1085277441 11:75309177-75309199 CTGCCTGAGCACTTTGATGCTGG - Intronic
1085782462 11:79422093-79422115 AAGGTTGAGCACTGAGAAGCAGG - Intronic
1086010047 11:82091296-82091318 CAGGCAGATCACAGAGATGCAGG + Intergenic
1088517931 11:110658748-110658770 CAACCTGAGTACTTGGATGCTGG - Intronic
1089140924 11:116283289-116283311 CAGGCTGAGCACTGGCAACTTGG - Intergenic
1090428675 11:126628188-126628210 CAGACAGTGCAGTGGGATGCAGG - Intronic
1091291413 11:134442342-134442364 CAGGCTGGGCCCTTGGGTGCTGG + Intergenic
1091294862 11:134466548-134466570 CAGCCTCAGCACGGGGCTGCAGG + Intergenic
1091337208 11:134781409-134781431 CAGGCTGAGAACTTGACTGCTGG + Intergenic
1094443624 12:30506556-30506578 CAGCCTGTGCACTGGGAGGATGG + Intergenic
1096075997 12:48805139-48805161 CAGGCTGGGAGCTGGGAGGCAGG + Intergenic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1101076465 12:101134496-101134518 TATGCTGAGCTCTGGGATGGTGG - Intergenic
1101692393 12:107093900-107093922 CCGGATGAGCACGGGGATGCGGG + Intergenic
1101820957 12:108184031-108184053 AAGGCTGAAGGCTGGGATGCAGG + Intronic
1102145150 12:110649684-110649706 CTGGCAGAGCCCTGGGATGTGGG + Intronic
1104704381 12:130932440-130932462 GAGGTTGAACGCTGGGATGCTGG + Intergenic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1106100338 13:26689854-26689876 CAGACTGAGCTCTGGGAGGCAGG + Intergenic
1108255245 13:48603437-48603459 CATGCTAACCACTGGGCTGCAGG - Intergenic
1109442490 13:62393981-62394003 AAGCCTGAACACTGGGCTGCTGG + Intergenic
1111697500 13:91643081-91643103 TAGGCTGAGCATGGGGATGGAGG + Intronic
1112018950 13:95354928-95354950 CAGGCTGAGGGTTGGGAGGCTGG - Intergenic
1112157129 13:96830609-96830631 CAGGTTGAGGACAGGCATGCTGG + Intronic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1114273604 14:21120989-21121011 CTGGCTGGCCACTGGGTTGCAGG + Intergenic
1114578218 14:23732298-23732320 CACACTTAGCACTGGCATGCAGG - Intergenic
1116012410 14:39366722-39366744 CTGGCAGAGCACTTGGATGGTGG + Intronic
1117869905 14:60189390-60189412 GCGGCTGAGAGCTGGGATGCTGG + Intergenic
1120263300 14:82216234-82216256 CAGGCTGAGCTCTGGGATCTGGG - Intergenic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122066315 14:99176298-99176320 CAGGCAGGGCACTGGGATCCCGG - Intronic
1122295977 14:100705968-100705990 CAGGCTGTGCACTGGGCTCGGGG + Intergenic
1122348406 14:101074238-101074260 CAGGGTGAGGTCTGGGCTGCAGG - Intergenic
1122543886 14:102511750-102511772 CAGGCTGTGCACTGGGCCTCAGG + Intergenic
1122663067 14:103310814-103310836 CAAGCTGAGCCCTGGGAAGGTGG - Intergenic
1122695587 14:103550644-103550666 CAGGCTGAGAACTGGGCCTCTGG - Intergenic
1122717959 14:103706713-103706735 CTGGCTGAGCACAGCGATGCCGG - Intronic
1122878023 14:104677755-104677777 CAGGCAGGGCACTGGCCTGCCGG + Intergenic
1122916843 14:104863399-104863421 CAGGCAGAGCACTGGGCACCAGG + Intergenic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1124216702 15:27813232-27813254 CAGGATGAGAAATGGGGTGCAGG + Intronic
1124235970 15:27989705-27989727 TAGGCTCATCACTGGGATGGCGG - Intronic
1124375008 15:29124211-29124233 CAGGCTGGACACTGGGCTGAGGG + Intronic
1125333598 15:38606016-38606038 CAGTCTGAGGACTGGGGTCCCGG - Intergenic
1126417017 15:48428290-48428312 CAGCCTCCACACTGGGATGCTGG - Intronic
1126583678 15:50262955-50262977 CAGGCTGTGCTCTGGAATGCAGG + Intronic
1127863754 15:63014928-63014950 CAGGAAGAGGCCTGGGATGCTGG + Intergenic
1128475988 15:67997226-67997248 CAGGCTGGGCAATGGGCTGGAGG - Intergenic
1129052979 15:72797553-72797575 CAGGCTTGGCACTGGGAGGGCGG + Intergenic
1129677645 15:77641105-77641127 AAGGCTGGGCCCTGGGATGGAGG + Intronic
1129731880 15:77937052-77937074 CAGACTGACCCCTGGGCTGCAGG + Intergenic
1131565858 15:93484756-93484778 TAGGCTGAGCACATGGGTGCAGG - Intergenic
1132018091 15:98336970-98336992 CAGGCTGTGGACTGGGAGGCAGG - Intergenic
1132393749 15:101457448-101457470 CAGCCTGCGCCCTGGGAGGCTGG - Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132993867 16:2812518-2812540 CTGGTTGAGGACTGGGGTGCAGG + Intergenic
1133706443 16:8359305-8359327 CAGGCTGAGACCTGGGATATTGG - Intergenic
1133848566 16:9480123-9480145 GAGGGTGAGCACTGGGGTGATGG + Intergenic
1134859875 16:17551650-17551672 CAGCCTGAGCACTGTGATGCTGG + Intergenic
1136599899 16:31278058-31278080 CAGGCAGAACACTGGCATGTGGG + Exonic
1137249061 16:46729794-46729816 CAGGCTGCACTCTGGGATGTAGG - Intronic
1137604820 16:49780392-49780414 CAGGCGGAGCACAGGGGTGCTGG + Intronic
1138279407 16:55761523-55761545 CAGGCTGAGGACTGGCAAGTTGG + Intergenic
1138289122 16:55832154-55832176 CAGGCTGAGGACTGGCAAGTTGG - Intronic
1138507099 16:57483902-57483924 CAGGCTGGGAGGTGGGATGCGGG - Intronic
1138529489 16:57627342-57627364 CAGGCTGAGGCCTGGGGTGCTGG + Intronic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1138686237 16:58728483-58728505 CAGGCTCTGTACTAGGATGCAGG - Intronic
1139507125 16:67404371-67404393 CAAGCTGAGCCCTAGGGTGCTGG - Intronic
1139576658 16:67846606-67846628 CAGTCTGTGCACTGGGGTGGGGG - Intronic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1141968567 16:87464142-87464164 CAGGCTGAGAGTTGGGAGGCTGG - Intronic
1142397309 16:89839583-89839605 CAGCCTGAGACCTGGGAAGCAGG + Intronic
1142644125 17:1301082-1301104 GAGGCTGCGCACTGGGAACCTGG + Intergenic
1142718747 17:1762653-1762675 CTGGCTGAGGGCTGGGATGGAGG + Intronic
1142896857 17:2985623-2985645 GAGGCTGAGCAGTGGTGTGCTGG - Intronic
1143091680 17:4452718-4452740 CAGGCTGGGACCTGGGGTGCAGG + Intronic
1143252311 17:5532763-5532785 CAGGATGGGCAGTGGGGTGCGGG + Intronic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145207968 17:20994751-20994773 CAGGGTGGGTGCTGGGATGCTGG - Intergenic
1145769190 17:27480125-27480147 CAGGATGAGCAATGGGGTGAAGG - Intronic
1145866762 17:28246749-28246771 CAGGCTGGGGTCTGGGATGGAGG + Intergenic
1145935752 17:28713876-28713898 CAGGCAGATCACTTGGATTCAGG - Intergenic
1146263020 17:31433886-31433908 CCAGCTGAGCACTGGAAGGCAGG - Intronic
1146640031 17:34533413-34533435 CAGGCAAAGCGCTGGTATGCGGG - Intergenic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1147155640 17:38543360-38543382 CAGGCGGAGCCCTGGGAAGAGGG + Intronic
1147167924 17:38603262-38603284 TGGGTTGGGCACTGGGATGCAGG - Intronic
1147443268 17:40460326-40460348 CAGGCTGGCCTCTGGGATGTTGG + Intergenic
1147684770 17:42280507-42280529 CAGCCTGACTCCTGGGATGCAGG - Intergenic
1147927137 17:43953062-43953084 CAGGCCGCGCTCTCGGATGCAGG + Intronic
1148000390 17:44384256-44384278 CAGCCTGAGAACTGGGATAAGGG + Intronic
1148431846 17:47649607-47649629 CCGGCTGAGCGCTGGGAGGAGGG - Intronic
1148703454 17:49606452-49606474 CAGGCTGGGCACAGTGGTGCTGG - Intronic
1148781599 17:50125212-50125234 CAGGCTGAGCCCTGTGGTCCTGG + Intronic
1151348750 17:73519205-73519227 CAGCCAGAGCTCTGGGGTGCTGG - Intronic
1151379785 17:73717738-73717760 CAGGCCCAGCGCTGGGAGGCTGG - Intergenic
1152278148 17:79369932-79369954 GAGGGTGAGCACTGGGCTGCAGG + Intronic
1152643454 17:81458469-81458491 GAGGCTGGGCTCTGGGGTGCTGG + Intronic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1154256132 18:12782250-12782272 CAAGCTGAGAACAGGGAAGCTGG - Intergenic
1154406323 18:14095317-14095339 CAGGCCTAGCACTGGGTTGCAGG + Intronic
1154437802 18:14360444-14360466 CCCGCAGAGCACTGGGATGGGGG + Intergenic
1156105682 18:33657333-33657355 GAGGCTGAGAATTGGGAGGCTGG + Intronic
1156480822 18:37435310-37435332 CAGGCTGGGGAATGGGCTGCAGG - Intronic
1156972290 18:43170920-43170942 CAGCCTGAGCACTGGGAGAATGG + Intergenic
1157078716 18:44497916-44497938 CAGGCTAAGCTCTGGGAAGGAGG + Intergenic
1157836987 18:50913558-50913580 CAGGCTGATCACTTGGAGTCAGG - Intronic
1158185367 18:54765317-54765339 GAGGGTGAGCACTGGGCTCCAGG - Intronic
1159958815 18:74539703-74539725 CAGGCTGAGCCTTGGCAAGCAGG - Intronic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160293393 18:77616231-77616253 CAGGCACAGCACCGGGGTGCAGG + Intergenic
1160611181 18:80086455-80086477 TAGGCTTAGCTCTGGAATGCTGG - Intronic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160787483 19:907728-907750 CAGGCCTGGCCCTGGGATGCTGG - Intronic
1160807935 19:1000805-1000827 CAGGCTGAGCACGGGGGTCTCGG - Exonic
1161026853 19:2040893-2040915 CAGGCTCTGCCCTGGGATGAGGG - Intronic
1161111202 19:2471277-2471299 CAGGCTGGGCACGGTGTTGCGGG - Intergenic
1161712969 19:5860234-5860256 CTGGCTGGGCACTGAGATGGTGG - Intergenic
1162453609 19:10769293-10769315 CATGCTGGGCTCTGGGGTGCTGG + Intronic
1163023435 19:14495897-14495919 TAGGCTGCGCGCGGGGATGCCGG - Intronic
1163129474 19:15263692-15263714 GAGGCTGAGAACTGGGGTGATGG - Intronic
1163155132 19:15435893-15435915 CAGGCGGATCACTGGAAGGCAGG + Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164896816 19:31883909-31883931 CAGACTGAGCTCTGGGTTCCAGG - Intergenic
1165273701 19:34731632-34731654 CGTGCTGTGCACTGGGCTGCAGG - Intergenic
1166109063 19:40611766-40611788 CAGGCTCAAGACTGGAATGCTGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166410610 19:42553741-42553763 CTGGCTGAGCTCTGAGATTCAGG - Intronic
1166866149 19:45838605-45838627 CAGGTTGGGCTCTGGGATGAGGG + Exonic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167260387 19:48454662-48454684 CAAGCTGAGGACAGGGATGCTGG - Exonic
1168165037 19:54541331-54541353 CAGGCTGATCACTGGAGTTCAGG - Intronic
1168281239 19:55306472-55306494 CAGTCCCAGCACTGGGCTGCAGG - Intronic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
925826808 2:7857490-7857512 CAGGCTGTGCACAGGGGTCCAGG + Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
927047823 2:19297761-19297783 CTGGCTTAACAGTGGGATGCTGG + Intergenic
927203628 2:20593477-20593499 CAGGCTGAACTCTGAGCTGCCGG + Intronic
927441079 2:23118405-23118427 CAGGCTGAGGTGTGGGTTGCAGG - Intergenic
927824457 2:26298545-26298567 CGGGCAGGGCACTGGGACGCGGG - Intergenic
929554466 2:42916785-42916807 CAGGCTGAGATCTGGGAAGAGGG - Intergenic
932357556 2:71078744-71078766 CAGGCTGAGCACCTGGGGGCAGG - Exonic
935582747 2:104772384-104772406 CAGGGTGTGCACTGCGAGGCTGG + Intergenic
937292027 2:120787546-120787568 CAGGCTGAGGGCTGGGGTGAAGG - Intronic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938593117 2:132758722-132758744 CAGGAAGAGGACTGGGATGGGGG + Intronic
938650542 2:133378455-133378477 GAAGCTGAGAAGTGGGATGCAGG - Intronic
938666327 2:133542066-133542088 CAGCCTCACAACTGGGATGCAGG - Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939107389 2:137964711-137964733 CAGGCTGGGCACAGGGATAAGGG + Intronic
944127332 2:196309196-196309218 CAGGCTGAGCTCTACCATGCAGG - Intronic
947012177 2:225578427-225578449 CAAGCAGAGCAGTGTGATGCAGG + Intronic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947745843 2:232506886-232506908 CAGCCTGAGTCCTGAGATGCAGG + Intergenic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
947940946 2:234054477-234054499 GAGGCTGAGATCTGGGATGAGGG + Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948387276 2:237588860-237588882 CACCATGACCACTGGGATGCCGG + Intronic
948925560 2:241094662-241094684 CAGGCTCAGCACTGACATTCTGG + Exonic
1169715096 20:8607132-8607154 CTGGCTGAGGAATGGGATGTGGG - Intronic
1170350233 20:15432459-15432481 CAGGATGAGCACTGGGCTGGAGG + Intronic
1172571525 20:35974543-35974565 CAGGCGGAGCACTGGGCGGCTGG + Intronic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1173225838 20:41161990-41162012 CCTGCTGCCCACTGGGATGCTGG - Intronic
1173447704 20:43134938-43134960 CAGGTTGAGGCCAGGGATGCTGG - Intronic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1174289857 20:49500393-49500415 CATGCTGAGGGCTGGGAAGCTGG - Intergenic
1174544132 20:51312587-51312609 CTGCCTGAGCACTGGGAGGATGG - Intergenic
1175191045 20:57212386-57212408 CTTGCTGAGCGCTGGGAAGCCGG + Intronic
1175771724 20:61628330-61628352 CCGGCTGAGCACAGGGGTGGGGG - Intronic
1176126180 20:63475904-63475926 CAGGCTCGGCACTGGAATGGTGG + Intergenic
1176262240 20:64187982-64188004 CAGGCAGAGCACTAGCATCCCGG - Intronic
1180078573 21:45475664-45475686 CTGGCTGGGGACAGGGATGCTGG + Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181484724 22:23223576-23223598 CTGGCTGAGCCCTAGGCTGCCGG + Intronic
1181637426 22:24180947-24180969 CAGGCTGAGCCCTGGGGCGGAGG - Intergenic
1182294371 22:29304568-29304590 AGGGCTGAGCACTGGGAGGGCGG - Intergenic
1182443923 22:30379536-30379558 CAGGCTGAGGACCGGGGTGCAGG + Exonic
1182444198 22:30380730-30380752 CAGGCTGGGTGCTGGGTTGCTGG - Intronic
1182691128 22:32164230-32164252 CACCCTGAGCACAGAGATGCAGG + Intergenic
1182740245 22:32562316-32562338 CAGGCTGAGGACAGGGCAGCGGG + Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183498680 22:38165069-38165091 GAGGATGGGGACTGGGATGCAGG - Intronic
1183554788 22:38516716-38516738 GAGGCAGAACACTGGGATGGGGG + Intergenic
1183899720 22:40996035-40996057 CAGGCTGAGTGCTGGCATGTGGG - Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1185275240 22:49947827-49947849 GTGGCTGGGCTCTGGGATGCTGG + Intergenic
949724532 3:7028129-7028151 CAGGCTAAGCACTGGGAAACTGG - Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
950224208 3:11220466-11220488 CAGGCTCTGCACTGGGTTGTAGG - Intronic
950437051 3:12986403-12986425 CAGGCAGACTACTGAGATGCAGG + Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
952401488 3:32967824-32967846 CAGGCAGGGTGCTGGGATGCAGG - Intergenic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954638805 3:52085909-52085931 CTGGCTGAGCTCCGGGATGTTGG + Intronic
954846976 3:53567954-53567976 CGGGCAGAGCACTAGGCTGCGGG + Intronic
955383841 3:58462970-58462992 CAGGCAGACCACTGGGCTGGAGG - Intergenic
960312499 3:116133538-116133560 CAGGAGGATCACTTGGATGCAGG - Intronic
961102145 3:124208735-124208757 CAGGATGATCACTTGAATGCAGG + Intronic
961387937 3:126534906-126534928 CCGGCTGGGGACAGGGATGCTGG - Intronic
961387953 3:126534970-126534992 CCGGCTGGGGACAGGGATGCTGG - Intronic
962995236 3:140620831-140620853 CAGCCTGAGAACTGAGAGGCTGG + Intergenic
968092925 3:195909441-195909463 CGGGCTGAGCCCTGCGCTGCCGG - Intronic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
969248671 4:5953181-5953203 CAGGCAGAGGGCTGGGATTCAGG - Intronic
969469198 4:7376972-7376994 CCGGCTCTGCACTGGGATTCGGG + Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969568899 4:7996396-7996418 CAGCCTGGGCACTGGGAACCTGG - Intronic
972365676 4:38372110-38372132 CAGGCTTACCTCTGTGATGCTGG + Intergenic
975281532 4:72568298-72568320 CAGCCAGAGCGCTGGGATCCCGG + Intronic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976464694 4:85354006-85354028 CAGGCTTAACACTGGGACGTGGG + Intergenic
978383099 4:108151589-108151611 AAGGTTGAGCAATGGCATGCAGG - Intronic
980398733 4:132251236-132251258 CAGGTTGGGCTATGGGATGCAGG - Intergenic
980795512 4:137677240-137677262 CTGCCTGTGCACTGGGATGATGG - Intergenic
981010819 4:139922990-139923012 CCTTCTGAGCACTGGGGTGCAGG - Intronic
981686213 4:147457798-147457820 CAGGCAGTGCACTGGGTAGCAGG - Intergenic
984641906 4:182175837-182175859 CATGCGGAACACTGGGATGATGG + Intronic
985308740 4:188574137-188574159 CAGACTGAGCACCGTAATGCGGG + Intergenic
985911616 5:2888114-2888136 AATGCTGAGCACTTGGGTGCTGG - Intergenic
986018108 5:3775414-3775436 TCAGCTGAGCCCTGGGATGCAGG - Intergenic
987752971 5:22065674-22065696 CTGAGTGATCACTGGGATGCTGG - Intronic
988565961 5:32320300-32320322 CAGGCCCAGCACTGGCCTGCAGG - Intergenic
989562817 5:42871012-42871034 CAGGGTGAGGCCTGTGATGCTGG - Intronic
990339824 5:54811163-54811185 CAGGACGAGCACTGAGATTCAGG + Intergenic
993101167 5:83541532-83541554 CTGGCAGAGCACTGGGCTGGGGG - Exonic
996053846 5:118963466-118963488 CAGGCTGAGGACTGACCTGCAGG + Intronic
996885253 5:128346188-128346210 CAGGCTAAGCACTGAAATGTTGG - Intronic
997581302 5:135019095-135019117 CAGGCTGATCACTGGCATCCAGG - Intergenic
998134825 5:139669040-139669062 CAGGCTGGCCACTGGCATCCAGG - Intronic
999237735 5:150109115-150109137 CAGGCTGAGCCCTGGGGTCAGGG - Intronic
1000971231 5:167717055-167717077 GAGGCTGAGCACTTGGATACAGG - Intronic
1001654982 5:173342393-173342415 CAGGCTGAGCAGTGGGCTTGAGG + Intergenic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002377021 5:178796104-178796126 CAGGCTGGGCCCAGGGCTGCAGG + Intergenic
1002438566 5:179251041-179251063 CCGGCTGAGCCCTGGGAGGGAGG - Intronic
1002913512 6:1509859-1509881 CAGGGTGAACCCTAGGATGCTGG - Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1005507907 6:26485723-26485745 CAGGCCTAGAACTGGGATGAAGG + Intergenic
1006449446 6:34097721-34097743 CCGGGTGGGCACTGAGATGCTGG - Intronic
1007040091 6:38713886-38713908 CAGGCAGTGGACTGGGAGGCAGG + Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1009315623 6:62215715-62215737 CGGGCTGATCACTGGTATTCTGG - Intronic
1011699624 6:89943262-89943284 TAGGCTGGGCCCTGGAATGCCGG + Intronic
1012084763 6:94810059-94810081 GAGGCTGATCACTGGTCTGCGGG - Intergenic
1013077946 6:106788088-106788110 CAGGCTTAGAGCTGGGAGGCAGG - Intergenic
1013375514 6:109510111-109510133 AAGGCTGGGGGCTGGGATGCCGG + Intronic
1014474606 6:121857137-121857159 CAGGCTGTGCACTGTGAGGCTGG - Intergenic
1017905789 6:158756943-158756965 CAGGCAGAGCACTGGGCACCTGG + Intronic
1017949931 6:159128009-159128031 CAGGGTGTGCTCTCGGATGCTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1019448978 7:1086707-1086729 CAGGCAGAGGACTGGGGTGCTGG - Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019750567 7:2726553-2726575 TAGGCTGAGCTCTGGGAGCCTGG - Intronic
1019781254 7:2941284-2941306 CAGGTTAATCACTGGGGTGCAGG - Intronic
1020405481 7:7828731-7828753 GAGGAGGAGCACTGGGAAGCTGG - Intronic
1021785747 7:24151046-24151068 TAGGGTGAGGACTGGGTTGCTGG + Intergenic
1025248902 7:57338621-57338643 CAGGCTGAGTGCAGGGATGTAGG + Intergenic
1026158589 7:67849289-67849311 CATGCTGGGCTCTGGCATGCAGG - Intergenic
1027050734 7:75019775-75019797 CAGCCTGTGCCCTGAGATGCAGG + Intronic
1029457331 7:100677876-100677898 CATGTTGAGCACTGGGACGGTGG - Intronic
1029515388 7:101020251-101020273 CAGGCTGGCCCCTGGGATGGGGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031790298 7:126093829-126093851 CAGCCTTAGCACTAGGATGTTGG - Intergenic
1031966971 7:128033323-128033345 CTAGCTGAGCCCTGGGAAGCCGG + Intronic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1032329259 7:130962498-130962520 CAGCCTGTGCACTGGGAGGAGGG - Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1033232346 7:139610336-139610358 AAGGCGGAGCACTGGGAGACTGG + Intronic
1034483445 7:151341386-151341408 TAGGCTGAGGAATGAGATGCGGG + Intergenic
1034844272 7:154430028-154430050 AAGGCTGAGAACTGGGAGGGTGG - Intronic
1035236129 7:157498699-157498721 GAGGCTGAGCGCTGGGAAGAAGG - Intergenic
1036238250 8:7061055-7061077 AAGGCTGAGCAATGGGCTGCCGG - Intergenic
1036582259 8:10086271-10086293 CAGGTTGAGCAGTTGGATGCTGG + Intronic
1038249540 8:25890306-25890328 CATGCCCAGCATTGGGATGCTGG + Intronic
1038792792 8:30683435-30683457 CGGGCTGAGGTGTGGGATGCCGG + Intronic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1039884286 8:41646467-41646489 CAGGCTGAGCACCGAGAAGGCGG + Exonic
1039897139 8:41724607-41724629 CAGAATCAGCCCTGGGATGCAGG + Intronic
1040601635 8:48890475-48890497 CACGCTGGGCGCAGGGATGCGGG + Intergenic
1042078593 8:65024005-65024027 CGCTCTGAGCACTGTGATGCTGG - Intergenic
1042651957 8:71052774-71052796 CAGATTGCGCACTGTGATGCTGG + Intergenic
1046071435 8:109259624-109259646 CAGGTTGAGTACTGGGAAGATGG + Intronic
1047817845 8:128484223-128484245 CAGGCTGATCACTTGGAGTCAGG - Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1048176178 8:132154608-132154630 CAGCCTGTGCAATGGGATGATGG + Intronic
1048377300 8:133833935-133833957 CCAGCTGAGAACTGGGATACTGG + Intergenic
1049069792 8:140347488-140347510 CAGGCTGAGGACAGGGCTGAAGG - Intronic
1049358888 8:142202457-142202479 CAGGCTGAGCACCGGGGGCCTGG + Intergenic
1049452304 8:142668886-142668908 CTGACTGGGGACTGGGATGCCGG - Intronic
1049474499 8:142790512-142790534 CAGGCTTGGCCCTGGGAAGCAGG - Intergenic
1049586696 8:143435701-143435723 CCGGCTGGGCAGTCGGATGCTGG - Intergenic
1050251816 9:3752826-3752848 CAGACTGACAACAGGGATGCTGG - Intergenic
1051658196 9:19402708-19402730 CAGGCAGAGCACTGGGGGGAGGG - Intergenic
1053415563 9:37944955-37944977 CAGGCTGAGCCCCTGGAGGCTGG + Intronic
1055483457 9:76733144-76733166 GAGGCTGAGTACTGTGATGCAGG - Intronic
1057233112 9:93337047-93337069 CAGGCTGAGAACTGGACTGGAGG + Intronic
1057933700 9:99218807-99218829 CAGCCTGAACACTGGGATACAGG + Exonic
1059725183 9:117001533-117001555 CAGGCAGAGCACTGGGAGAGTGG - Intronic
1060374351 9:123105306-123105328 CAGGCTGAGCACCTGGGGGCCGG + Intergenic
1060726893 9:126012090-126012112 GAGCCTGACAACTGGGATGCTGG - Intergenic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060869292 9:127026816-127026838 CAGGGTGGGGACTGGCATGCAGG + Intronic
1060892599 9:127198282-127198304 AAGGCTGAGCACTGGGAAAGGGG - Intronic
1060972153 9:127744534-127744556 CTGGCTGTGCACTGGGGTGGAGG - Intronic
1061523936 9:131141972-131141994 CTCACTGTGCACTGGGATGCAGG - Intronic
1062013491 9:134279824-134279846 CAGGCTGAGCTCTTGGCTCCTGG + Intergenic
1062069037 9:134545548-134545570 CAGGCTGAGCTCTGGGTCTCGGG - Intergenic
1062112368 9:134789055-134789077 GAGGCTGTGCACTGGCATGCAGG + Intronic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062457720 9:136647275-136647297 CAGGCTGAGCCCAGGGTGGCAGG + Intergenic
1062630635 9:137461659-137461681 CAGGCTGGGGACTGGCAGGCGGG - Intronic
1062637469 9:137499051-137499073 GAGGAGGAGCCCTGGGATGCTGG + Intronic
1186724930 X:12347087-12347109 CAGACTGGGCACAGGAATGCAGG + Intronic
1188209198 X:27399040-27399062 CCAGAAGAGCACTGGGATGCAGG + Intergenic
1189095509 X:38134540-38134562 CAGGCTGAGGAGTGGGCTGCTGG + Intronic
1189288444 X:39868308-39868330 CAGGCAAAGCCCTGGGAAGCTGG - Intergenic
1190768377 X:53494529-53494551 CAGGCTGAGCTCTTGTTTGCAGG + Intergenic
1192476021 X:71443936-71443958 CAGGCAGATCACTGGAATTCAGG - Intronic
1196234019 X:113258227-113258249 TAGGCTTATCCCTGGGATGCAGG - Intergenic
1196315871 X:114222695-114222717 CAGCCAGAGCACTGAGATTCAGG + Intergenic
1201357316 Y:13111681-13111703 CAGGCAGAGCACCAGGATGCAGG - Intergenic