ID: 926149284

View in Genome Browser
Species Human (GRCh38)
Location 2:10415704-10415726
Sequence CTGGACTCCCCCCGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926149284_926149297 25 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149297 2:10415752-10415774 CAAGGTCCCCCGAGCAGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 133
926149284_926149291 20 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149291 2:10415747-10415769 CTCCCCAAGGTCCCCCGAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 148
926149284_926149288 7 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149288 2:10415734-10415756 GGAAGTTGACCACCTCCCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 127
926149284_926149298 26 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149298 2:10415753-10415775 AAGGTCCCCCGAGCAGGGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 109
926149284_926149299 29 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149299 2:10415756-10415778 GTCCCCCGAGCAGGGGTGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 310
926149284_926149292 21 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149292 2:10415748-10415770 TCCCCAAGGTCCCCCGAGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 151
926149284_926149294 22 Left 926149284 2:10415704-10415726 CCTGTTATTCGGGGGGAGTCCAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 926149294 2:10415749-10415771 CCCCAAGGTCCCCCGAGCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926149284 Original CRISPR CTGGACTCCCCCCGAATAAC AGG (reversed) Intronic
903652828 1:24931754-24931776 CTGGACTCACCCCGACCACCGGG + Intronic
913535303 1:119766586-119766608 TTTGACTCCCTCCAAATAACTGG + Intronic
914847714 1:151292096-151292118 CTGCACTCCCCCAGAAAACCTGG + Exonic
1067562731 10:47315192-47315214 CTGGATTCCCCCCAAATACCTGG + Intergenic
1070161640 10:73870484-73870506 TTGGACCCCCCCAGAAGAACAGG + Intronic
1074618182 10:115092176-115092198 CTGGAGTCCCACCAAAGAACAGG - Intergenic
1079052858 11:17178491-17178513 TTGTTCTCCCCCAGAATAACAGG - Intronic
1086915792 11:92528686-92528708 CTGGACTCCCTCAAAAGAACTGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088276090 11:108087539-108087561 CTGGACTCCTCCTGAGTAGCTGG - Intronic
1089875940 11:121722463-121722485 CTGGACTCCCTCCGAGAAGCAGG - Intergenic
1107600382 13:42006554-42006576 CTGGAGTCCCTCTGAAGAACTGG - Intergenic
1108131095 13:47301066-47301088 CTGGACTCTTCCCAAGTAACAGG - Intergenic
1127389078 15:58490824-58490846 CTGCCCTCCTCCCTAATAACTGG - Intronic
1128581752 15:68815609-68815631 CTGGGCTCCACCCCAATCACAGG - Intronic
1128753385 15:70164701-70164723 CTGGACTCACCATGACTAACAGG - Intergenic
1135558222 16:23454609-23454631 CTCCCCTCCCCCCAAATAACTGG - Intergenic
1146837211 17:36121455-36121477 CTTGCCTCCCACCGACTAACAGG - Intergenic
1157125872 18:44955361-44955383 CTGGATTCAACCCGAAGAACTGG + Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
926149284 2:10415704-10415726 CTGGACTCCCCCCGAATAACAGG - Intronic
931267834 2:60676187-60676209 CTCAACCCCCCCCGAGTAACTGG + Intergenic
1174914350 20:54639200-54639222 CTGGACTCCCTCCCTATAAAGGG + Intronic
1175263575 20:57689478-57689500 CTGGACTCCCCAGGAGGAACGGG - Intronic
1180208864 21:46281367-46281389 CTGGACTGCTCCTGAGTAACAGG + Intronic
966643574 3:182217362-182217384 CTGGAATCCCCACGTTTAACAGG + Intergenic
982669789 4:158306596-158306618 CTAGACTCCCACCCAATGACAGG + Intergenic
990944795 5:61238585-61238607 CTGGCTTCCCCCAGAATAAGTGG - Intergenic
1007873826 6:45071626-45071648 CTGGAGTGCACCCTAATAACTGG - Intronic
1015009309 6:128324897-128324919 CTGTAGTCTCCCAGAATAACTGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1185980653 X:4774424-4774446 CTGGCCTCCTCCTGAATAGCTGG + Intergenic
1186815697 X:13235709-13235731 CTGAACTCCACCCTAATTACAGG + Intergenic
1189081718 X:37980290-37980312 CTGGATTCCCCACGAAGTACTGG + Intronic
1201423346 Y:13823139-13823161 CTGGACTCCACCCATGTAACAGG - Intergenic