ID: 926153722

View in Genome Browser
Species Human (GRCh38)
Location 2:10438986-10439008
Sequence AGCTTGGCGTAGCCACTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926153722_926153726 0 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153726 2:10439009-10439031 GTGGTCAGAAGCGAGGTTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 113
926153722_926153725 -7 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153725 2:10439002-10439024 CCAAGCTGTGGTCAGAAGCGAGG 0: 1
1: 0
2: 1
3: 15
4: 161
926153722_926153728 2 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153728 2:10439011-10439033 GGTCAGAAGCGAGGTTTCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 134
926153722_926153727 1 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153727 2:10439010-10439032 TGGTCAGAAGCGAGGTTTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 135
926153722_926153729 21 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG 0: 1
1: 0
2: 0
3: 7
4: 39
926153722_926153730 22 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153730 2:10439031-10439053 GGGCCACTCACGTGTAGCACGGG 0: 1
1: 0
2: 0
3: 9
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926153722 Original CRISPR AGCTTGGCGTAGCCACTTAC AGG (reversed) Intergenic
901239582 1:7685293-7685315 GGCTTGGAGGAGCCACTCACAGG + Intronic
901325851 1:8364726-8364748 AGCGTGACGAGGCCACTTACTGG + Exonic
911391062 1:97244137-97244159 AGCTTGTGGTGGCCACCTACAGG - Intronic
912502947 1:110134423-110134445 AGCTTGCCTTTGCCACTGACTGG - Intergenic
922586791 1:226739222-226739244 GGCTTGGCGTCGCCACTGCCGGG - Intronic
1063054033 10:2484027-2484049 AGTTTGGGGGAGCGACTTACAGG - Intergenic
1066956565 10:42178475-42178497 ATTTTGGCATAGCAACTTACAGG - Intergenic
1071976647 10:90962489-90962511 AATTTGGCTTGGCCACTTACTGG + Intergenic
1075214451 10:120519964-120519986 AGCTTGTCCTTGCCACTTACGGG + Intronic
1077651547 11:3977695-3977717 AACTTGGCTTTGCCACTTACTGG + Intronic
1080584775 11:33671929-33671951 AGCTTGGAGTAGGGACTGACTGG + Exonic
1083044881 11:59725387-59725409 ACCTTGGCTGAGCCACTCACAGG + Intronic
1083152000 11:60797876-60797898 AACCTGGCATGGCCACTTACTGG - Intronic
1085043088 11:73338286-73338308 ATCCTGGCTTGGCCACTTACTGG - Intronic
1085473339 11:76772192-76772214 ATCTTGGCTTTGCCACTTCCTGG - Intergenic
1101873209 12:108582137-108582159 AGCTGGGCGCAGGCACTTTCTGG + Intergenic
1102894297 12:116586295-116586317 ATCTTGGCTCTGCCACTTACTGG + Intergenic
1107663224 13:42661414-42661436 AACTTGGCGAAACCACTCACTGG - Intergenic
1111292614 13:86187802-86187824 AGATTGACATAGCCACTTTCAGG - Intergenic
1118611311 14:67542438-67542460 AACTTGGCTCTGCCACTTACTGG + Intronic
1119718218 14:76873680-76873702 ATCTTGGCGTTGCTACTTACTGG - Intergenic
1127945168 15:63744325-63744347 AGCTTGCCGTAACCACTCCCTGG + Intronic
1135757936 16:25113387-25113409 AACTGAGCGTTGCCACTTACTGG + Intronic
1136160142 16:28414684-28414706 AGCTTGGCGCAGCCCCACACAGG - Intergenic
1136202946 16:28700607-28700629 AGCTTGGCGCAGCCCCGCACAGG + Intronic
1137559962 16:49496172-49496194 ATCTTGGCTCTGCCACTTACTGG + Intronic
1142674692 17:1506603-1506625 AGCTTGGCCCAGCCAGTTACTGG - Intronic
1142960330 17:3548493-3548515 TGCTTGGCATGGCCACTTCCTGG + Intronic
1144739840 17:17575691-17575713 AGCTTGGTGTAGCCAAACACAGG - Intronic
1144853500 17:18255909-18255931 AGCTGGGCTTTGCCACTTCCTGG - Intronic
1147647304 17:42041313-42041335 ATCCTGGCTTTGCCACTTACTGG + Intronic
1151276597 17:73039050-73039072 ATCTTGGCTCAGCTACTTACTGG + Intronic
1166738787 19:45101842-45101864 GGCTTGGCGTAGCCTCATATTGG + Intronic
926153722 2:10438986-10439008 AGCTTGGCGTAGCCACTTACAGG - Intergenic
927932675 2:27055251-27055273 AGGCTGGGGAAGCCACTTACCGG - Exonic
940187891 2:151007024-151007046 ATCTTGGCTTTGCCACTTATCGG + Intronic
940265779 2:151835043-151835065 AGCATGACTTAGCCATTTACTGG - Exonic
941658709 2:168171994-168172016 AGCTTGGCCTTGCCATTTACTGG + Intronic
946021539 2:216643766-216643788 AGCTTGGCGTAGACTCTTGGAGG + Intronic
947406347 2:229781513-229781535 AGCCTGGCCTGCCCACTTACTGG - Intronic
948370541 2:237486791-237486813 TATTTGGCGTTGCCACTTACTGG + Intronic
950836476 3:15924502-15924524 ATCTTGGCTTTGCCACTTTCTGG + Intergenic
951635540 3:24770889-24770911 AGGATGGTGTTGCCACTTACAGG - Intergenic
951830010 3:26916058-26916080 AGCCTGGCTTTGCCACTGACAGG + Intergenic
956443098 3:69299190-69299212 AGCTTGGTGTAGCTCCTTCCAGG + Intronic
960676995 3:120204664-120204686 AGCCTGGCGCAGACACTTCCAGG - Intronic
961995518 3:131237906-131237928 ACCTTGTCGTAGCTTCTTACTGG + Intronic
978621947 4:110641434-110641456 AGCTTGGCCTGGCGACTTGCGGG - Intronic
981497020 4:145405316-145405338 AGCGTGGGGAAGCCACTTATTGG + Intergenic
987747564 5:21995709-21995731 AGCTTGGAGTAGCCAAATAGTGG - Intronic
991767745 5:70005509-70005531 AGCTTGGAGTAGCCAAATAATGG - Intergenic
991846979 5:70880585-70880607 AGCTTGGAGTAGCCAAATAATGG - Intergenic
993493839 5:88585861-88585883 AGTTTGGCATTGTCACTTACTGG + Intergenic
997607130 5:135183081-135183103 ATCTTGGCTTAGTCGCTTACTGG + Intronic
1000668435 5:164028067-164028089 ATCCTGGCCTTGCCACTTACTGG + Intergenic
1003378520 6:5601621-5601643 ACCTTGGCTCTGCCACTTACTGG + Intronic
1005082528 6:21971123-21971145 AGCTTGGTGTAGCTTCCTACAGG - Intergenic
1012874045 6:104704866-104704888 AGCATCTCGTAGTCACTTACTGG + Intergenic
1025082071 7:55992498-55992520 AGATTGGCTTAGTCACTCACAGG + Intronic
1030083842 7:105800368-105800390 AGCTTGGTGTAGCCTCCTTCAGG + Intronic
1035116311 7:156527213-156527235 TGCTTGGCATAGCCCCTTTCAGG + Intergenic
1035579206 8:729358-729380 AGCTTGGCGTGTCCCCTTGCAGG - Intronic
1044904385 8:96984682-96984704 TGTTTGGCTTTGCCACTTACTGG + Intronic
1046861656 8:119099523-119099545 ATCCTGGCTTTGCCACTTACTGG - Intronic
1048048824 8:130797964-130797986 ATCTTGGCTTTGCCACTTAGTGG + Intronic
1049312244 8:141939306-141939328 AGCTTGGTGTCTCCACTCACCGG + Intergenic
1052756767 9:32550462-32550484 ATCGTGGCGTCACCACTTACAGG - Intronic
1057391203 9:94642782-94642804 ACCCTGGCCTGGCCACTTACTGG + Intergenic
1060851409 9:126879975-126879997 AGCTTTGCGCAGCCGCTTACAGG + Exonic
1186637677 X:11423901-11423923 AGCTTGGCCTTGTGACTTACTGG - Intronic
1187952703 X:24486285-24486307 AGCTTGGGGTGGCCTCTTCCTGG - Intronic
1189520507 X:41762440-41762462 AGTTTGGAGTAGACACCTACAGG + Intronic
1190337716 X:49272353-49272375 ATCCTGGCGCTGCCACTTACTGG + Intronic
1197902700 X:131391111-131391133 TCCTTGGGGTAGACACTTACTGG + Intronic
1199057904 X:143319302-143319324 AGCTTGGCTTACCCACTGCCGGG - Intergenic