ID: 926153729

View in Genome Browser
Species Human (GRCh38)
Location 2:10439030-10439052
Sequence GGGGCCACTCACGTGTAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926153722_926153729 21 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT No data
Right 926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG No data
926153724_926153729 5 Left 926153724 2:10439002-10439024 CCAAGCTGTGGTCAGAAGCGAGG No data
Right 926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926153729 Original CRISPR GGGGCCACTCACGTGTAGCA CGG Intergenic