ID: 926153729

View in Genome Browser
Species Human (GRCh38)
Location 2:10439030-10439052
Sequence GGGGCCACTCACGTGTAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926153724_926153729 5 Left 926153724 2:10439002-10439024 CCAAGCTGTGGTCAGAAGCGAGG 0: 1
1: 0
2: 0
3: 17
4: 156
Right 926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG 0: 1
1: 0
2: 0
3: 7
4: 39
926153722_926153729 21 Left 926153722 2:10438986-10439008 CCTGTAAGTGGCTACGCCAAGCT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG 0: 1
1: 0
2: 0
3: 7
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926153729 Original CRISPR GGGGCCACTCACGTGTAGCA CGG Intergenic
916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG + Exonic
918115120 1:181489570-181489592 GGGGGCACTCAAATGTAACAGGG - Intronic
922767999 1:228165986-228166008 GGGGCCACGCACGCGCAGCAGGG - Exonic
1065455015 10:25898296-25898318 GGGGCCAGGCATGTGTAACATGG + Intergenic
1072686220 10:97538950-97538972 GGAGCCACTCATCTGTAACATGG - Intronic
1072702266 10:97651201-97651223 GGTCCCACTAACATGTAGCAGGG - Intronic
1076841513 10:133048218-133048240 GAGGCCACTCACGTGTGGACAGG + Intergenic
1079159007 11:17975335-17975357 GGGGTCACTCACATTTATCAAGG - Intronic
1085703173 11:78763332-78763354 GGGGCCACTCGAGTGCAGCATGG - Intronic
1091723993 12:2833235-2833257 GGGGCCAAACACATGTAGGATGG + Intronic
1093000474 12:13990482-13990504 GGGGCCACTGCAGTGTTGCATGG - Intergenic
1103494622 12:121352122-121352144 GGCGCCTCTCACCTGCAGCAGGG + Exonic
1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG + Exonic
1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG + Intronic
1126782585 15:52151205-52151227 GGGGCCACACACCTGTATCGTGG + Intronic
1129310912 15:74708391-74708413 GGGGCCACACACCTGAGGCAGGG - Intergenic
1129961225 15:79686935-79686957 GGGGGCAGTCAAGTGTGGCAAGG - Intergenic
1132012041 15:98284642-98284664 GGTGCCACTAACATGTTGCAGGG - Intergenic
1134239479 16:12494870-12494892 GGTGCCACTGATGTGAAGCAGGG - Intronic
1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG + Intronic
1152068147 17:78122593-78122615 GGGGCCACTCACCTTCAGCCGGG + Exonic
1152929147 17:83101125-83101147 GGGACCACTCAAGAGTAGCCGGG - Intergenic
1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG + Intergenic
1161697255 19:5776305-5776327 GGGCCCACTCACCTGTAGTACGG - Exonic
1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168171789 19:54594526-54594548 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168685701 19:58347834-58347856 GGGGACACTCACGTGTGGCGCGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
935141914 2:100360864-100360886 GGGGCCACACATGTTTAACATGG - Intergenic
943971707 2:194417156-194417178 GTGGCCACTCACATGTTTCAAGG + Intergenic
947645161 2:231733534-231733556 GGGGCCACTCACTTGGCACATGG - Intronic
1180783707 22:18535522-18535544 GGGGCCACTCAGGTGATGCTGGG - Intergenic
1181127277 22:20709573-20709595 GGGGCCACTCAGGTGATGCTGGG - Intronic
954084867 3:48236302-48236324 GGGGCCAGGCATGTCTAGCATGG + Intergenic
957885544 3:86282559-86282581 GGGACCAGGCACATGTAGCAGGG - Intergenic
986002636 5:3642344-3642366 GTGGCCACTCACCTCTAGCCTGG - Intergenic
995805836 5:116051586-116051608 GGGGGCACTCCCCAGTAGCATGG - Intronic
1022132405 7:27416616-27416638 GGAGCCACTCCCGTGTGCCAGGG + Intergenic
1023056233 7:36292134-36292156 CGGGGCACTCACATGTAGCGTGG - Intronic
1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG + Intronic
1049015879 8:139919762-139919784 TGGGCCACACACTGGTAGCATGG - Intronic
1049730516 8:144175325-144175347 GGGGCAGCTCAGGTGTAGCAGGG - Intronic
1049756548 8:144313606-144313628 GGCTCCACTCACGTCCAGCAGGG - Exonic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic
1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG + Intergenic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1193271117 X:79530916-79530938 GGGACCCCTCGCGTGGAGCAGGG - Intergenic