ID: 926153753

View in Genome Browser
Species Human (GRCh38)
Location 2:10439193-10439215
Sequence CCACTGCCACTAAGCGATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926153745_926153753 24 Left 926153745 2:10439146-10439168 CCTTAGTTGATTTTGAGTGGAAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153747_926153753 -1 Left 926153747 2:10439171-10439193 CCCCCTTTTCAGTCCAAGCTCAC 0: 1
1: 0
2: 2
3: 9
4: 185
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153750_926153753 -4 Left 926153750 2:10439174-10439196 CCTTTTCAGTCCAAGCTCACCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153743_926153753 30 Left 926153743 2:10439140-10439162 CCAAAGCCTTAGTTGATTTTGAG 0: 1
1: 0
2: 1
3: 6
4: 153
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153748_926153753 -2 Left 926153748 2:10439172-10439194 CCCCTTTTCAGTCCAAGCTCACC 0: 1
1: 0
2: 0
3: 13
4: 159
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153749_926153753 -3 Left 926153749 2:10439173-10439195 CCCTTTTCAGTCCAAGCTCACCA 0: 1
1: 0
2: 0
3: 45
4: 744
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40
926153746_926153753 0 Left 926153746 2:10439170-10439192 CCCCCCTTTTCAGTCCAAGCTCA 0: 1
1: 0
2: 2
3: 18
4: 176
Right 926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926153753 Original CRISPR CCACTGCCACTAAGCGATCT CGG Intergenic
904555643 1:31361679-31361701 CAACTGCGCCTATGCGATCTGGG + Intronic
905538557 1:38742546-38742568 CCACTGCCACTAAGAGTTCCAGG + Intergenic
918329382 1:183442850-183442872 CCACTGGCCCTAAGCATTCTAGG + Intergenic
1069984587 10:72274526-72274548 CCCCTGCCCCCAAGCAATCTGGG - Intronic
1077186425 11:1237351-1237373 CCCCTGGCACGAAGCCATCTTGG + Intronic
1084417380 11:69040846-69040868 CCACAGCCACTGAGCAAGCTTGG + Intergenic
1089975766 11:122730233-122730255 CCACAGCCACCAAGCCATCTCGG - Intronic
1092229846 12:6770290-6770312 CCCCTGCCACACAGGGATCTGGG - Intronic
1111308488 13:86448567-86448589 CCACTGCCTCTGAGCTTTCTGGG - Intergenic
1112199666 13:97262345-97262367 CCACTGCCACGGAGAGATCAAGG - Intronic
1114403085 14:22427986-22428008 CCACTGCCACCAAATGATTTTGG + Intergenic
1117129038 14:52666045-52666067 ACACTGCCACTGTGTGATCTTGG + Intronic
1128336594 15:66790193-66790215 CCAGTGCCACTCAGCTTTCTGGG - Intergenic
1129254503 15:74326546-74326568 CCACTGCCACTGAGCGCTGGTGG - Intronic
1130820511 15:87490291-87490313 CCACTGCCACTATGAGATGGGGG + Intergenic
1135541076 16:23330859-23330881 CGACTGCCCTTAAGAGATCTCGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1150305999 17:64085805-64085827 CCCCTGCCACTAGGAGATCCTGG + Intronic
1153795698 18:8619979-8620001 CCACTGTCACTAACTGATTTTGG - Intronic
1158340991 18:56465965-56465987 CCACTCCCACTTAGACATCTGGG + Intergenic
1159446829 18:68551169-68551191 CAACAGCCACTTAGCGATCTTGG - Intergenic
1165708135 19:37990837-37990859 CCAATGCCACTAAGTCATCATGG - Intronic
926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG + Intergenic
931174767 2:59842768-59842790 CCACTGCCACTAAAAGACATCGG + Intergenic
937400996 2:121583530-121583552 CCACTGCCACTTATCCATTTTGG + Intronic
942196287 2:173523767-173523789 CCATTGCCAATAAGAGGTCTTGG - Intergenic
946815349 2:223571520-223571542 CCCCTTGCACTCAGCGATCTGGG - Intergenic
1178981620 21:37269393-37269415 CCACTCACACTAAGGGATTTAGG - Intergenic
1180954672 22:19736339-19736361 CCACTGCCACTAGGCCCACTGGG + Intergenic
956231551 3:67022328-67022350 CCACAGTCACTCAGTGATCTTGG - Intergenic
961832513 3:129631218-129631240 CCAGTGCAATTAAGCAATCTCGG - Intergenic
975651073 4:76593788-76593810 CCACTGCCCCTAAGTGAAATAGG - Intronic
996512063 5:124327984-124328006 CCTCTGCCAGTAAGCATTCTGGG - Intergenic
997913890 5:137904308-137904330 CAGCTTCCACTAAGTGATCTGGG + Intronic
998981850 5:147712628-147712650 CCACCTCCACTAAGCAATATTGG - Intronic
1001739221 5:174035926-174035948 CCACTGCTAGTCAGCCATCTTGG + Intergenic
1011430517 6:87281533-87281555 CCACAGCCACTTAGAGCTCTGGG + Intergenic
1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG + Intronic
1037899667 8:22680349-22680371 CAACTTCCACTAAGCCAGCTGGG + Intergenic
1050876976 9:10651246-10651268 CCACTGCCTCTATGCCATCTGGG + Intergenic
1051323883 9:15943199-15943221 ACACTGCCACCATGCGAACTAGG - Intronic
1052347992 9:27429192-27429214 CCACTTCAACTAAGAGGTCTTGG + Intronic
1059470027 9:114497953-114497975 CCACGGCCACAAAGCCAGCTTGG + Intronic
1186203903 X:7181628-7181650 CCACTGCCTCTAGGTGATGTTGG - Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic