ID: 926154883

View in Genome Browser
Species Human (GRCh38)
Location 2:10448249-10448271
Sequence ACGCCGGCCCGAGGTGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926154865_926154883 19 Left 926154865 2:10448207-10448229 CCCCCGCCGCGCCCGTCAGCGCC 0: 1
1: 0
2: 1
3: 52
4: 486
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154870_926154883 13 Left 926154870 2:10448213-10448235 CCGCGCCCGTCAGCGCCTGGCTC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154866_926154883 18 Left 926154866 2:10448208-10448230 CCCCGCCGCGCCCGTCAGCGCCT 0: 1
1: 0
2: 0
3: 16
4: 234
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154877_926154883 -10 Left 926154877 2:10448236-10448258 CCGCCCGCCGGAGACGCCGGCCC 0: 1
1: 0
2: 1
3: 28
4: 180
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154872_926154883 7 Left 926154872 2:10448219-10448241 CCGTCAGCGCCTGGCTCCCGCCC 0: 1
1: 0
2: 3
3: 35
4: 387
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154876_926154883 -9 Left 926154876 2:10448235-10448257 CCCGCCCGCCGGAGACGCCGGCC 0: 1
1: 0
2: 1
3: 29
4: 175
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154864_926154883 22 Left 926154864 2:10448204-10448226 CCGCCCCCGCCGCGCCCGTCAGC 0: 1
1: 0
2: 7
3: 65
4: 623
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154874_926154883 -2 Left 926154874 2:10448228-10448250 CCTGGCTCCCGCCCGCCGGAGAC 0: 1
1: 0
2: 2
3: 19
4: 163
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154871_926154883 8 Left 926154871 2:10448218-10448240 CCCGTCAGCGCCTGGCTCCCGCC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154867_926154883 17 Left 926154867 2:10448209-10448231 CCCGCCGCGCCCGTCAGCGCCTG 0: 1
1: 0
2: 1
3: 10
4: 152
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86
926154868_926154883 16 Left 926154868 2:10448210-10448232 CCGCCGCGCCCGTCAGCGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 310
Right 926154883 2:10448249-10448271 ACGCCGGCCCGAGGTGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926154883 Original CRISPR ACGCCGGCCCGAGGTGGCGC CGG Exonic