ID: 926157624

View in Genome Browser
Species Human (GRCh38)
Location 2:10466035-10466057
Sequence GGCAGATGGCTTTGGGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157624_926157630 7 Left 926157624 2:10466035-10466057 CCTGTACCCCAAAGCCATCTGCC No data
Right 926157630 2:10466065-10466087 TCTGTGTTTACTTAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157624 Original CRISPR GGCAGATGGCTTTGGGGTAC AGG (reversed) Intergenic
No off target data available for this crispr