ID: 926157748

View in Genome Browser
Species Human (GRCh38)
Location 2:10466955-10466977
Sequence TGAGGGCAAAAGATGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157748_926157751 -10 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157751 2:10466968-10466990 TTTGCCCTCAGCACCAACGCTGG No data
926157748_926157756 8 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157748_926157762 27 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157748_926157754 2 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157748 Original CRISPR TGAGGGCAAAAGATGCCTTG GGG (reversed) Intergenic
No off target data available for this crispr