ID: 926157749

View in Genome Browser
Species Human (GRCh38)
Location 2:10466956-10466978
Sequence CTGAGGGCAAAAGATGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157749_926157754 1 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data
926157749_926157756 7 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157749_926157762 26 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157749 Original CRISPR CTGAGGGCAAAAGATGCCTT GGG (reversed) Intergenic
No off target data available for this crispr