ID: 926157751

View in Genome Browser
Species Human (GRCh38)
Location 2:10466968-10466990
Sequence TTTGCCCTCAGCACCAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157746_926157751 11 Left 926157746 2:10466934-10466956 CCGCAGGAGGCTGCTCAAGGGCC No data
Right 926157751 2:10466968-10466990 TTTGCCCTCAGCACCAACGCTGG No data
926157748_926157751 -10 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157751 2:10466968-10466990 TTTGCCCTCAGCACCAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157751 Original CRISPR TTTGCCCTCAGCACCAACGC TGG Intergenic
No off target data available for this crispr