ID: 926157752

View in Genome Browser
Species Human (GRCh38)
Location 2:10466972-10466994
Sequence GGGGCCAGCGTTGGTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157752_926157762 10 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157752_926157756 -9 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157752_926157764 30 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157764 2:10467025-10467047 AGGAGAGAGAACCGACAGCAGGG No data
926157752_926157763 29 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157763 2:10467024-10467046 TAGGAGAGAGAACCGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157752 Original CRISPR GGGGCCAGCGTTGGTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr