ID: 926157753

View in Genome Browser
Species Human (GRCh38)
Location 2:10466973-10466995
Sequence GGGGGCCAGCGTTGGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157753_926157756 -10 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157753_926157763 28 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157763 2:10467024-10467046 TAGGAGAGAGAACCGACAGCAGG No data
926157753_926157762 9 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157753_926157765 30 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157765 2:10467026-10467048 GGAGAGAGAACCGACAGCAGGGG No data
926157753_926157764 29 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157764 2:10467025-10467047 AGGAGAGAGAACCGACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157753 Original CRISPR GGGGGCCAGCGTTGGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr