ID: 926157754

View in Genome Browser
Species Human (GRCh38)
Location 2:10466980-10467002
Sequence ACCAACGCTGGCCCCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157749_926157754 1 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data
926157748_926157754 2 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data
926157750_926157754 0 Left 926157750 2:10466957-10466979 CCAAGGCATCTTTTGCCCTCAGC No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data
926157746_926157754 23 Left 926157746 2:10466934-10466956 CCGCAGGAGGCTGCTCAAGGGCC No data
Right 926157754 2:10466980-10467002 ACCAACGCTGGCCCCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157754 Original CRISPR ACCAACGCTGGCCCCCAAGA TGG Intergenic
No off target data available for this crispr