ID: 926157755

View in Genome Browser
Species Human (GRCh38)
Location 2:10466981-10467003
Sequence GCCATCTTGGGGGCCAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157755_926157764 21 Left 926157755 2:10466981-10467003 CCAACGCTGGCCCCCAAGATGGC No data
Right 926157764 2:10467025-10467047 AGGAGAGAGAACCGACAGCAGGG No data
926157755_926157763 20 Left 926157755 2:10466981-10467003 CCAACGCTGGCCCCCAAGATGGC No data
Right 926157763 2:10467024-10467046 TAGGAGAGAGAACCGACAGCAGG No data
926157755_926157765 22 Left 926157755 2:10466981-10467003 CCAACGCTGGCCCCCAAGATGGC No data
Right 926157765 2:10467026-10467048 GGAGAGAGAACCGACAGCAGGGG No data
926157755_926157762 1 Left 926157755 2:10466981-10467003 CCAACGCTGGCCCCCAAGATGGC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157755 Original CRISPR GCCATCTTGGGGGCCAGCGT TGG (reversed) Intergenic
No off target data available for this crispr