ID: 926157756

View in Genome Browser
Species Human (GRCh38)
Location 2:10466986-10467008
Sequence GCTGGCCCCCAAGATGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157750_926157756 6 Left 926157750 2:10466957-10466979 CCAAGGCATCTTTTGCCCTCAGC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157749_926157756 7 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157748_926157756 8 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157746_926157756 29 Left 926157746 2:10466934-10466956 CCGCAGGAGGCTGCTCAAGGGCC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157752_926157756 -9 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data
926157753_926157756 -10 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157756 2:10466986-10467008 GCTGGCCCCCAAGATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157756 Original CRISPR GCTGGCCCCCAAGATGGCCT TGG Intergenic
No off target data available for this crispr