ID: 926157758

View in Genome Browser
Species Human (GRCh38)
Location 2:10466992-10467014
Sequence CATGTGCCAAGGCCATCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157758_926157765 11 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157765 2:10467026-10467048 GGAGAGAGAACCGACAGCAGGGG No data
926157758_926157762 -10 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157758_926157767 29 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157767 2:10467044-10467066 AGGGGTCTCCTAGAGTCATCTGG No data
926157758_926157768 30 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157768 2:10467045-10467067 GGGGTCTCCTAGAGTCATCTGGG No data
926157758_926157764 10 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157764 2:10467025-10467047 AGGAGAGAGAACCGACAGCAGGG No data
926157758_926157763 9 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157763 2:10467024-10467046 TAGGAGAGAGAACCGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157758 Original CRISPR CATGTGCCAAGGCCATCTTG GGG (reversed) Intergenic
No off target data available for this crispr