ID: 926157762

View in Genome Browser
Species Human (GRCh38)
Location 2:10467005-10467027
Sequence TTGGCACATGCTGCAGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926157748_926157762 27 Left 926157748 2:10466955-10466977 CCCCAAGGCATCTTTTGCCCTCA No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157749_926157762 26 Left 926157749 2:10466956-10466978 CCCAAGGCATCTTTTGCCCTCAG No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157755_926157762 1 Left 926157755 2:10466981-10467003 CCAACGCTGGCCCCCAAGATGGC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157750_926157762 25 Left 926157750 2:10466957-10466979 CCAAGGCATCTTTTGCCCTCAGC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157752_926157762 10 Left 926157752 2:10466972-10466994 CCCTCAGCACCAACGCTGGCCCC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157758_926157762 -10 Left 926157758 2:10466992-10467014 CCCCAAGATGGCCTTGGCACATG No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157753_926157762 9 Left 926157753 2:10466973-10466995 CCTCAGCACCAACGCTGGCCCCC No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data
926157757_926157762 -9 Left 926157757 2:10466991-10467013 CCCCCAAGATGGCCTTGGCACAT No data
Right 926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926157762 Original CRISPR TTGGCACATGCTGCAGTCGT AGG Intergenic
No off target data available for this crispr