ID: 926158873

View in Genome Browser
Species Human (GRCh38)
Location 2:10474303-10474325
Sequence TCTGGGTGCCCGTACTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926158873_926158883 13 Left 926158873 2:10474303-10474325 CCCCCCCAGTACGGGCACCCAGA No data
Right 926158883 2:10474339-10474361 TCCACACCCACAACCTCTGCAGG No data
926158873_926158885 14 Left 926158873 2:10474303-10474325 CCCCCCCAGTACGGGCACCCAGA No data
Right 926158885 2:10474340-10474362 CCACACCCACAACCTCTGCAGGG No data
926158873_926158890 27 Left 926158873 2:10474303-10474325 CCCCCCCAGTACGGGCACCCAGA No data
Right 926158890 2:10474353-10474375 CTCTGCAGGGACAGGCCACCCGG No data
926158873_926158887 19 Left 926158873 2:10474303-10474325 CCCCCCCAGTACGGGCACCCAGA No data
Right 926158887 2:10474345-10474367 CCCACAACCTCTGCAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926158873 Original CRISPR TCTGGGTGCCCGTACTGGGG GGG (reversed) Intergenic
No off target data available for this crispr