ID: 926160280

View in Genome Browser
Species Human (GRCh38)
Location 2:10482930-10482952
Sequence GAATCTTTGGTTCTAATATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926160280_926160290 30 Left 926160280 2:10482930-10482952 CCGAATATTAGAACCAAAGATTC No data
Right 926160290 2:10482983-10483005 GAGCTCTGTCTCAAAAACCGGGG No data
926160280_926160285 8 Left 926160280 2:10482930-10482952 CCGAATATTAGAACCAAAGATTC No data
Right 926160285 2:10482961-10482983 CCCCTATCTACAAAGGTTTCAGG No data
926160280_926160288 28 Left 926160280 2:10482930-10482952 CCGAATATTAGAACCAAAGATTC No data
Right 926160288 2:10482981-10483003 AGGAGCTCTGTCTCAAAAACCGG No data
926160280_926160283 1 Left 926160280 2:10482930-10482952 CCGAATATTAGAACCAAAGATTC No data
Right 926160283 2:10482954-10482976 CCGAGCACCCCTATCTACAAAGG No data
926160280_926160289 29 Left 926160280 2:10482930-10482952 CCGAATATTAGAACCAAAGATTC No data
Right 926160289 2:10482982-10483004 GGAGCTCTGTCTCAAAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926160280 Original CRISPR GAATCTTTGGTTCTAATATT CGG (reversed) Intergenic
No off target data available for this crispr