ID: 926161524

View in Genome Browser
Species Human (GRCh38)
Location 2:10493477-10493499
Sequence CCCTTTAACCACAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926161517_926161524 -4 Left 926161517 2:10493458-10493480 CCGCCTCCCAGGTGCCAAGCCCT No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data
926161514_926161524 15 Left 926161514 2:10493439-10493461 CCTAGGCCTAAGTCTTGTGCCGC No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data
926161519_926161524 -10 Left 926161519 2:10493464-10493486 CCCAGGTGCCAAGCCCTTTAACC No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data
926161518_926161524 -7 Left 926161518 2:10493461-10493483 CCTCCCAGGTGCCAAGCCCTTTA No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data
926161515_926161524 9 Left 926161515 2:10493445-10493467 CCTAAGTCTTGTGCCGCCTCCCA No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data
926161513_926161524 18 Left 926161513 2:10493436-10493458 CCTCCTAGGCCTAAGTCTTGTGC No data
Right 926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926161524 Original CRISPR CCCTTTAACCACAAGGAAGC AGG Intergenic
No off target data available for this crispr