ID: 926167337

View in Genome Browser
Species Human (GRCh38)
Location 2:10529729-10529751
Sequence GCCAATCCTGGAAGCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926167337_926167344 17 Left 926167337 2:10529729-10529751 CCTGAGTGGCTTCCAGGATTGGC No data
Right 926167344 2:10529769-10529791 CAACTGCACCTCGAGCCCGCTGG No data
926167337_926167339 -10 Left 926167337 2:10529729-10529751 CCTGAGTGGCTTCCAGGATTGGC No data
Right 926167339 2:10529742-10529764 CAGGATTGGCACAGACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926167337 Original CRISPR GCCAATCCTGGAAGCCACTC AGG (reversed) Intergenic
No off target data available for this crispr