ID: 926169079

View in Genome Browser
Species Human (GRCh38)
Location 2:10539731-10539753
Sequence TCCCAGCTCCACCGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926169076_926169079 -7 Left 926169076 2:10539715-10539737 CCAACAGGGCAGCACGTCCCAGC No data
Right 926169079 2:10539731-10539753 TCCCAGCTCCACCGGGACGCAGG No data
926169072_926169079 18 Left 926169072 2:10539690-10539712 CCAAGTTAGTGAACGCATCCGCA No data
Right 926169079 2:10539731-10539753 TCCCAGCTCCACCGGGACGCAGG No data
926169075_926169079 0 Left 926169075 2:10539708-10539730 CCGCACGCCAACAGGGCAGCACG No data
Right 926169079 2:10539731-10539753 TCCCAGCTCCACCGGGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926169079 Original CRISPR TCCCAGCTCCACCGGGACGC AGG Intergenic
No off target data available for this crispr