ID: 926171635

View in Genome Browser
Species Human (GRCh38)
Location 2:10556413-10556435
Sequence GAGCTTTACCTTTGCTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171635_926171647 29 Left 926171635 2:10556413-10556435 CCTTAAGAGCAAAGGTAAAGCTC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140
926171635_926171636 -1 Left 926171635 2:10556413-10556435 CCTTAAGAGCAAAGGTAAAGCTC No data
Right 926171636 2:10556435-10556457 CGCCCCCGCGAGTCCCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171635 Original CRISPR GAGCTTTACCTTTGCTCTTA AGG (reversed) Intergenic