ID: 926171637

View in Genome Browser
Species Human (GRCh38)
Location 2:10556437-10556459
Sequence CACCATGGGGGGACTCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171637_926171654 25 Left 926171637 2:10556437-10556459 CCCCCGCGAGTCCCCCCATGGTG No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG No data
926171637_926171648 14 Left 926171637 2:10556437-10556459 CCCCCGCGAGTCCCCCCATGGTG No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG No data
926171637_926171649 15 Left 926171637 2:10556437-10556459 CCCCCGCGAGTCCCCCCATGGTG No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171637_926171647 5 Left 926171637 2:10556437-10556459 CCCCCGCGAGTCCCCCCATGGTG No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171637 Original CRISPR CACCATGGGGGGACTCGCGG GGG (reversed) Intergenic