ID: 926171638

View in Genome Browser
Species Human (GRCh38)
Location 2:10556438-10556460
Sequence GCACCATGGGGGGACTCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171638_926171647 4 Left 926171638 2:10556438-10556460 CCCCGCGAGTCCCCCCATGGTGC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140
926171638_926171649 14 Left 926171638 2:10556438-10556460 CCCCGCGAGTCCCCCCATGGTGC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171638_926171654 24 Left 926171638 2:10556438-10556460 CCCCGCGAGTCCCCCCATGGTGC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 179
926171638_926171648 13 Left 926171638 2:10556438-10556460 CCCCGCGAGTCCCCCCATGGTGC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG 0: 1
1: 0
2: 12
3: 52
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171638 Original CRISPR GCACCATGGGGGGACTCGCG GGG (reversed) Intergenic