ID: 926171639

View in Genome Browser
Species Human (GRCh38)
Location 2:10556439-10556461
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171639_926171649 13 Left 926171639 2:10556439-10556461 CCCGCGAGTCCCCCCATGGTGCC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171639_926171647 3 Left 926171639 2:10556439-10556461 CCCGCGAGTCCCCCCATGGTGCC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140
926171639_926171654 23 Left 926171639 2:10556439-10556461 CCCGCGAGTCCCCCCATGGTGCC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 179
926171639_926171648 12 Left 926171639 2:10556439-10556461 CCCGCGAGTCCCCCCATGGTGCC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG 0: 1
1: 0
2: 12
3: 52
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171639 Original CRISPR GGCACCATGGGGGGACTCGC GGG (reversed) Intergenic