ID: 926171641

View in Genome Browser
Species Human (GRCh38)
Location 2:10556448-10556470
Sequence GTGACGTCAGGCACCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171641_926171654 14 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG No data
926171641_926171648 3 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG No data
926171641_926171649 4 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171641_926171657 26 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171641_926171647 -6 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171641 Original CRISPR GTGACGTCAGGCACCATGGG GGG (reversed) Intergenic