ID: 926171643

View in Genome Browser
Species Human (GRCh38)
Location 2:10556450-10556472
Sequence GCGTGACGTCAGGCACCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171643_926171649 2 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171643_926171648 1 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG No data
926171643_926171657 24 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171643_926171647 -8 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171643_926171654 12 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171643 Original CRISPR GCGTGACGTCAGGCACCATG GGG (reversed) Intergenic