ID: 926171644

View in Genome Browser
Species Human (GRCh38)
Location 2:10556451-10556473
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171644_926171649 1 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171644_926171654 11 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG No data
926171644_926171648 0 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG No data
926171644_926171657 23 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171644_926171647 -9 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171644 Original CRISPR AGCGTGACGTCAGGCACCAT GGG (reversed) Intergenic