ID: 926171645

View in Genome Browser
Species Human (GRCh38)
Location 2:10556452-10556474
Sequence GAGCGTGACGTCAGGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171645_926171654 10 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 179
926171645_926171649 0 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171645_926171648 -1 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG 0: 1
1: 0
2: 12
3: 52
4: 450
926171645_926171657 22 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171645_926171647 -10 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171645 Original CRISPR GAGCGTGACGTCAGGCACCA TGG (reversed) Intergenic