ID: 926171646

View in Genome Browser
Species Human (GRCh38)
Location 2:10556460-10556482
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171646_926171648 -9 Left 926171646 2:10556460-10556482 CCTGACGTCACGCTCTGCCCATC No data
Right 926171648 2:10556474-10556496 CTGCCCATCCCAGGCCTCCATGG No data
926171646_926171649 -8 Left 926171646 2:10556460-10556482 CCTGACGTCACGCTCTGCCCATC No data
Right 926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG No data
926171646_926171657 14 Left 926171646 2:10556460-10556482 CCTGACGTCACGCTCTGCCCATC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171646_926171654 2 Left 926171646 2:10556460-10556482 CCTGACGTCACGCTCTGCCCATC No data
Right 926171654 2:10556485-10556507 AGGCCTCCATGGGTGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171646 Original CRISPR GATGGGCAGAGCGTGACGTC AGG (reversed) Intergenic