ID: 926171647

View in Genome Browser
Species Human (GRCh38)
Location 2:10556465-10556487
Sequence CGTCACGCTCTGCCCATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171645_926171647 -10 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171640_926171647 2 Left 926171640 2:10556440-10556462 CCGCGAGTCCCCCCATGGTGCCT No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171644_926171647 -9 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171643_926171647 -8 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171641_926171647 -6 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171639_926171647 3 Left 926171639 2:10556439-10556461 CCCGCGAGTCCCCCCATGGTGCC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171637_926171647 5 Left 926171637 2:10556437-10556459 CCCCCGCGAGTCCCCCCATGGTG No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171638_926171647 4 Left 926171638 2:10556438-10556460 CCCCGCGAGTCCCCCCATGGTGC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171635_926171647 29 Left 926171635 2:10556413-10556435 CCTTAAGAGCAAAGGTAAAGCTC No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data
926171642_926171647 -7 Left 926171642 2:10556449-10556471 CCCCCATGGTGCCTGACGTCACG No data
Right 926171647 2:10556465-10556487 CGTCACGCTCTGCCCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171647 Original CRISPR CGTCACGCTCTGCCCATCCC AGG Intergenic